Search: Messages Per Page:
[0:00:04] moderator partner DesertP: greats8YoTrip
[0:00:07] DumboAKAwumbo: gongmas 
[0:00:10] premium mg42_: syadouPop
[0:00:14] subscriber premium KamiGousama: greats8OTrip
[0:00:23] broadcaster turbo GreatSphynx: lol i fell asleep during zeldo 
[0:00:24] TheRealLupos: greats8YoTrip
[0:00:27] subscriber twitch-recap-2023 ocarina_boy: greats8YoTrip gongo
[0:00:28] Dust1210: OYOTrip
[0:00:30] subscriber snosa: hapiCat hapiCat hapiCat
[0:00:35] subscriber premium ThisIsNotAPlaceOfHonor: Whoops 
[0:00:35] vip twitch-recap-2023 squirrelcabinet: BedgeCat
[0:00:37] subscriber twitch-recap-2023 ocarina_boy: jmikeSquandance
[0:00:43] subscriber premium Flopgopple: MERRY gongo MAS 
[0:00:44] Bladestorm01: Let's gongoooooooooooo 
[0:00:46] subscriber snosa: BedgeCat <-- streamer 
[0:01:00] BRUCE_IRONSTAUNCH: gongo mas is overed 
[0:01:00] budderdog_: Sleepo gongo
[0:01:09] subscriber premium ThisIsNotAPlaceOfHonor: catPls
[0:01:13] subscriber purplestufff: gon gorp 
[0:01:18] subscriber solberserker: chat what did Gongo Claus give you 
[0:01:26] subscriber KatalepsyKills: catPls
[0:01:28] twitch-recap-2023 milkwalker_png: Goopy
[0:01:28] Njack33: merry gonmas everyone 
[0:01:32] budderdog_: Geepy
[0:01:37] Bladestorm01: gongo Claus gave me Lego! 
[0:01:39] subscriber purplestufff: @solberserker he gave me gongo
[0:01:41] subscriber twitch-recap-2023 Gnatley: gongo claus gave me indigestion 
[0:01:42] endlessgrapes: oh gongo...! 
[0:01:43] twitch-recap-2023 wallacewellactually: i got a bowser figurine LETSGO 
[0:01:59] premium hfredguy: pissAlien pissAlien pissAlien
[0:02:08] vip twitch-recap-2023 viahate: veryCat
[0:02:17] IS0Moon: Merry gongmas I got sony headphones! catPls
[0:02:31] vip subscriber twitch-recap-2023 Whats_Aleppo: gongmas 
[0:02:42] Bladestorm01: also got raycons 
[0:02:49] TheRealLupos: Stand back everyone! I'm about to gongo ! 
[0:02:50] aimlessdemon: Merry gongo mas. I have a cassette player and Mario Wonder 
[0:02:52] subscriber premium KamiGousama: i can actually gong because i have a afternoon shift today greats8SPRIGGLE
[0:02:56] twitch-recap-2023 franceybear: hellooo gongo osmoPat
[0:03:07] subscriber snosa: OYOTrip
[0:03:09] twitch-recap-2023 franceybear: OYOTrip
[0:03:12] subscriber premium ThisIsNotAPlaceOfHonor: OYOTrip
[0:03:13] aimlessdemon: GAMESTER 
[0:03:17] subscriber hypn0toad5: gongo OYOTrip
[0:03:18] subscriber snosa: immediate gamester 
[0:03:18] subscriber bitesperry: osmoPat
[0:03:19] vip twitch-recap-2023 viahate: another greats8YoTrip
[0:03:21] turbo nivis_shadoth: I've got morning shift. so it's gonna be a sleep gongo for me. 
[0:03:24] deworming_in_progress: OYOTrip it happened 
[0:03:25] subscriber twitch-recap-2023 ocarina_boy: gamester Clap
[0:03:42] vip subscriber twitch-recap-2023 Whats_Aleppo: @viahate evening viahate limesHey hope you had a wonderful day limesLove
[0:03:43] subscriber premium KamiGousama: @nivis_shadoth greats8OdoNo
[0:03:47] subscriber twitch-recap-2023 Gnatley: OYOTrip a gamester has risen 
[0:03:53] subscriber premium ThisIsNotAPlaceOfHonor: Merry Gongmas I got depression in my stocking :)
[0:03:55] subscriber twitch-recap-2023 n0tthedoctor: greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE
[0:04:05] subscriber overwatch-league-insider_1 Howoriginal: On the 12th night of gongo mas my Gong gave to me 
[0:04:25] premium nickynack: ITS A CHRISTMAS GONGO OYOTrip
[0:04:29] subscriber twitch-recap-2023 n0tthedoctor: covid symptoms are starting to subside greats8Happi
[0:04:35] moderator partner DesertP: gerbert has special needs 
[0:04:37] cherrrybomb567: Merry Gongmas y'all! DinoDance
[0:04:41] vip premium plorf: GerbShock
[0:04:43] subscriber snosa: so true 
[0:04:55] RDSk: Pepechill DrumTime <— drumming with his feet 
[0:05:01] subscriber premium ThisIsNotAPlaceOfHonor: Grrr Bert 
[0:05:06] grumzirg: i knew it was gongmas all along 
[0:05:07] vip subscriber twitch-recap-2023 Whats_Aleppo: @ocarina_boy evening ocarina limesHi limesLove hope you had a merry Christmas 
[0:05:07] Salty_peanut: yo gongsmas 
[0:05:08] subscriber snosa: Pepechill DrumTime <— drumming with his feet 
[0:05:11] subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM
[0:05:13] subscriber twitch-recap-2023 Gnatley: has anyone gongo
[0:05:27] broadcaster turbo GreatSphynx: congrats 
[0:05:29] Njack33: Im gonging so hard right now 
[0:05:33] broadcaster turbo GreatSphynx: soirry i was heating up chinese food 
[0:05:38] subscriber snosa: Tasty
[0:05:44] subscriber twitch-recap-2023 ocarina_boy: @Whats_Aleppo Thanks Gov, Hope you did too jmikeMask
[0:05:46] premium Syluxrox: @GreatSphynx what kind mr gong 
[0:05:47] vip twitch-recap-2023 viahate: @Whats_Aleppo hi aleppo sumsaltHi I had to get up early but managed to nap so a pretty good day. hope you had a good holiday too! sumsaltLove
[0:05:48] vip TheRealLupos: Gerbert's special needs include being bullied 
[0:05:48] vip GodliestCat64: gongmas greats8YoTrip
[0:05:59] broadcaster turbo GreatSphynx: chow mein 
[0:06:04] RDSk: Tasty give us chinese food 
[0:06:09] subscriber twitch-recap-2023 n0tthedoctor: A succulent Chinesr meal
[0:06:20] subscriber twitch-recap-2023 n0tthedoctor: Chinese* 
[0:06:26] squeejam: Buhh
[0:06:29] moderator partner DesertP: remember the episode of gerbert with the first person camera where gerbert chased a cat 
[0:06:36] Salty_peanut: Funnywhitecat5
[0:06:47] budderdog_: osmoStare GerbShock
[0:07:09] vip twitch-recap-2023 bruxisma: bruxisma subscribed at Tier 1. They've subscribed for 35 months! thirty five months of gongo mas 
[0:07:11] RDSk: this song is sampling that weird meowing tube that Joel was torturing us with 
[0:07:15] broadcaster turbo GreatSphynx: ty brux 
[0:07:40] deworming_in_progress: Crunch <-- me eating the chopsticks after finishing my chinese food 
[0:07:44] subscriber solberserker: Sphynx shae some Chinese food now 
[0:08:31] vip uforgot: good time for spenXD osmoPat
[0:08:43] IS0Moon: Give some chow mein to osmoLick
[0:08:55] subscriber KatalepsyKills: GettingJiggyWithIt
[0:09:02] subscriber hypn0toad5: GettingJiggyWithIt
[0:09:30] RDSk: there should be a J Jonah Jameson emote for when chat demands pictures of Osmo osmoLick
[0:09:35] subscriber twitch-recap-2023 carlysle_: greats8JAM
[0:09:58] subscriber solberserker: Sphynx question do you eat Chinese food every Christmas Day? 
[0:10:12] subscriber premium ThisIsNotAPlaceOfHonor: Chinese food on Christmas is a Jewish tradition 
[0:10:13] Spie812: Corb Corb Corb
[0:10:14] subscriber twitch-recap-2023 Gnatley: GettingJiggyWithIt
[0:10:16] subscriber solberserker: like is that a real thing Jewish people do? 
[0:10:27] subscriber solberserker: I always thought it was some sterotype tbh 
[0:10:29] premium Iceckryss: gongo is the cause and solution of all our problems 
[0:10:41] Artacus: CatGuitar CatGuitar CatGuitar
[0:10:42] subscriber kakabookake: happy life day everyone daxMug
[0:10:45] vip artist-badge MagnetismMelodic: that's why we are jewish 
[0:10:52] subscriber solberserker: WE ARE JEWISH 
[0:10:54] subscriber premium ThisIsNotAPlaceOfHonor: WE ARE JEWISH 
[0:10:59] vip artist-badge MagnetismMelodic: WE ARE JEWISH 
[0:11:02] vip GodliestCat64: I could go for some general tso's chicken spanX
[0:11:05] vip TheRealLupos: Because Arab and Chinese food places are usually open during Christmas 
[0:11:07] subscriber solberserker: Italian-Americans we eat Seafood on Christmas Eve 
[0:11:10] subscriber turbo rkdn42: I'm not sure if I've legit had chinese food since before the pandemic 
[0:11:31] subscriber snosa: OYTrip
[0:11:32] vip TheRealLupos: OYTrip
[0:11:32] moderator partner DesertP: greats8Ytrip
[0:11:32] budderdog_: OYTrip
[0:11:34] IS0Moon: greats8Ytrip
[0:11:34] subscriber sub-gift-leader evilmarsrover: Yeah sorry not typing that on Jesus's birthday my grandmother would emerge from a hole and drag me to the 7th circle 
[0:11:34] subscriber twitch-recap-2023 Gnatley: OYTrip
[0:11:36] Salty_peanut: OYTrip
[0:11:37] subscriber premium ThisIsNotAPlaceOfHonor: OYTrip
[0:11:37] subscriber twitch-recap-2023 n0tthedoctor: greats8Ytrip
[0:11:38] Artacus: i hear it 
[0:11:38] vip whette_fahrtz: OYZTrip
[0:11:39] vip GodliestCat64: OYTrip
[0:11:39] vip twitch-recap-2023 blaseGraham: greats8Ytrip
[0:11:42] subscriber turbo rkdn42: other than ready meals and panda express (doesn't really count) 
[0:11:42] thetwitch3r: OYTrip
[0:11:48] subscriber sub-gift-leader evilmarsrover: greats8Ytrip
[0:11:49] Dust1210: OYTrip
[0:11:53] subscriber solberserker: HUHH
[0:11:57] subscriber sub-gifter explodes5: Time for your daily gongo
[0:11:58] subscriber bits unspelld: OYTrip
[0:11:59] vip whette_fahrtz: Roiker
[0:12:02] subscriber solberserker: jmikeMald
[0:12:03] vip TheRealLupos: bruleWhere
[0:12:05] subscriber snosa: catSittingPolitely
[0:12:06] subscriber hunnietoots: its a gongmas miracle OYOTrip
[0:12:07] subscriber twitch-recap-2023 n0tthedoctor: greats8Ytrip greats8Ytrip greats8Ytrip greats8Ytrip
[0:12:13] IS0Moon: greats8YoTrip
[0:12:14] subscriber twitch-recap-2023 n0tthedoctor: greats8YoTrip greats8YoTrip
[0:12:16] subscriber sub-gift-leader evilmarsrover: OYOTrip
[0:12:16] subscriber snosa: nelson 
[0:12:17] subscriber premium KamiGousama: i just had chinese because they were open. then i made Japanese curry because i only make it once a year during winter 
[0:12:17] subscriber premium ThisIsNotAPlaceOfHonor: OYOTrip
[0:12:17] subscriber solberserker: Nelson 
[0:12:17] RDSk: catSittingPolitely catSittingPolitely catSittingPolitely
[0:12:21] deworming_in_progress: full nelson 
[0:12:21] vip GodliestCat64: Speaking of italian I went to open stream on my tv and saw that they've got Nick stellino on hungry 
[0:12:21] subscriber turbo rkdn42: luftbalon 
[0:12:23] vip whette_fahrtz: haaa haaa 
[0:12:26] univers__ltd: oh shit lmao 
[0:12:26] Artacus: stock laugh 
[0:12:27] subscriber sub-gift-leader evilmarsrover: EleGiggle
[0:12:28] bigjetboy123: daxMug
[0:12:31] vip artist-badge MagnetismMelodic: patGlu
[0:12:31] Salty_peanut: cum 
[0:12:32] budderdog_: !cum 
[0:12:32] moderator partner Nightbot: Roiker MilkTime BERMUS MilkTime Roiker MilkTime
[0:12:34] vip artist-badge MagnetismMelodic: OOOOOOOH SHIT 
[0:12:36] subscriber sub-gifter explodes5: greats8ZooTrip
[0:12:36] Lastrin: Merry christmas gongo
[0:12:37] vip artist-badge MagnetismMelodic: GLUE ON THE WORKS BRO 
[0:12:38] twitch-recap-2023 wallacewellactually: NELSON 
[0:12:39] premium mg42_: LOOK AT THE GLUUUUE 
[0:12:40] subscriber twitch-recap-2023 n0tthedoctor: Glue 2020Suspicious LUL
[0:12:40] vip whette_fahrtz: Peppino! That’s not a glue! 
[0:12:41] broadcaster turbo GreatSphynx: no clue what this is 
[0:12:41] subscriber hunnietoots: eat glue daxMug
[0:12:42] vip artist-badge Guardison: gormless 
[0:12:44] vip GodliestCat64: GLUE ON THE WORKS 
[0:12:46] Startex360: I can't fall asleep tonight 
[0:12:47] vip twitch-recap-2023 viahate: catPls
[0:12:49] Salty_peanut: what the fuck are those 
[0:12:49] subscriber bits unspelld: nose 
[0:12:51] subscriber premium ThisIsNotAPlaceOfHonor: catPls
[0:12:51] premium hfredguy: dbjDiddy dbjDiddy dbjDiddy dbjDiddy
[0:12:51] budderdog_: lmao 
[0:12:54] Origfx: carols 
[0:12:58] vip whette_fahrtz: Dreamworks Antz 
[0:12:59] twitch-recap-2023 Annonn140: zzooTrip
[0:13:00] vip TheRealLupos: the Beetles 
[0:13:00] vip GodliestCat64: Oh shit 
[0:13:00] vip artist-badge MagnetismMelodic: what insects are those 
[0:13:02] Origfx: catPls
[0:13:03] subscriber solberserker: Sphynx found this in-between the couch pillows 
[0:13:07] subscriber turbo puppetself: Cool Bee universe PogChamp
[0:13:11] broadcaster turbo GreatSphynx: they only live 21 days 
[0:13:11] Spie812: I hate them 
[0:13:12] subscriber snosa: catPls
[0:13:13] Startex360: I know these bugs 
[0:13:13] vip artist-badge MagnetismMelodic: i feel like i've seen these caterpillars before 
[0:13:13] squeejam: I don't want to unmute them 
[0:13:14] subscriber sub-gifter explodes5: Is this Bugz Lyfe? 
[0:13:17] vip GodliestCat64: Where tf have I seen that worm before 
[0:13:18] subscriber solberserker: this is like Proto Bugs Life
[0:13:18] IS0Moon: Sphynx if you don't know how do we know its not borno 
[0:13:19] subscriber sub-gifter explodes5: Bugz Life 2 
[0:13:20] vip artist-badge MagnetismMelodic: oh i get it 
[0:13:24] vip whette_fahrtz: I would spray these little shits with so much Raid oh my god 
[0:13:33] subscriber overwatch-league-insider_1 Howoriginal: Beetles only live 21 days catPls
[0:13:41] Bladestorm01: DinoDance DinoDance DinoDance
[0:13:41] aimlessdemon: PEACE AND LUV 
[0:13:48] Salty_peanut: someone alert paul 
[0:13:52] Njack33: why is the 1 song a herbie and hermie thats two things 
[0:13:53] premium Count_Nacula: Lies! that's 2 things on the first day! greats8YoTrip
[0:13:55] Artacus: gaither's pond + bugs life 
[0:14:08] vip whette_fahrtz: greats8Daxmug KILL BUG LENNON greats8Daxmug
[0:14:08] vip twitch-recap-2023 blaseGraham: we have Bugs Life at home. Bugs Life at home: 
[0:14:09] subscriber sub-gifter explodes5: Wait you got worms on the 1st day? 
[0:14:10] deworming_in_progress: what the hell is a hormie 
[0:14:21] broadcaster turbo GreatSphynx: hermie simpson 
[0:14:24] vip artist-badge MagnetismMelodic: these designs make me wish for a bug's eath 
[0:14:35] vip twitch-recap-2023 blaseGraham: eath 
[0:14:43] subscriber sub-gifter explodes5: this is like those animation collections on G4 
[0:14:51] vip Snudl: chatPls
[0:14:51] vip TheRealLupos: !god 
[0:14:51] Spie812: It's not that much worse than Antz tbh 
[0:14:51] moderator partner Nightbot: gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog
[0:14:54] deworming_in_progress: GLORY TO GOD 
[0:14:55] mick_sq: gongo gonguito gongazo 
[0:14:55] premium Syluxrox: GLORY TO GOD 
[0:14:55] Njack33: GLORY TO GOD 
[0:14:56] aimlessdemon: Glory to all mankind 
[0:14:56] Salty_peanut: god mentioned 
[0:14:57] Artacus: bug helter skelter 
[0:14:59] premium mg42_: GLORY TO GOD syadouPray
[0:15:01] univers__ltd: GLORY TO gongo
[0:15:01] subscriber hunnietoots: gyat 
[0:15:03] premium Count_Nacula: Hurmie and Wormy gotta fight to the death 
[0:15:11] premium Syluxrox: @mg42_ shondo viewer syadouLove syadouWave
[0:15:14] vip whette_fahrtz: OYTrip why did the lice have dumptruck asses 
[0:15:21] cabinessence66: wideVIBE
[0:15:22] cabinessence66: ? 
[0:15:25] twitch-recap-2023 Fireborn: zzooTrip
[0:15:32] subscriber kakabookake: NotLikeThis
[0:15:33] premium mg42_: @Syluxrox cornBLAYAYACK
[0:15:37] subscriber premium ThisIsNotAPlaceOfHonor: If god exists, then explain this video 
[0:15:41] Bladestorm01: OF course it's RELIGIOUS LUL
[0:15:43] Artacus: oh worm? 
[0:15:45] subscriber sub-gifter maxzlock: hey gongo whats goin on in he- OH GOD 
[0:15:46] twitch-recap-2023 Fireborn: it keeps going TheVoices
[0:15:47] subscriber snosa: w! catSnail
[0:15:48] subscriber premium KamiGousama: greats8JAM
[0:15:50] Salty_peanut: dead 
[0:15:58] vip whette_fahrtz: catPls
[0:15:58] deworming_in_progress: the half-second of "GLORY TO GOD" makes this feel like a subliminal video 
[0:16:02] broadcaster turbo GreatSphynx: catBoom catBoom catBoom catBoom
[0:16:03] subscriber sub-gifter explodes5: wait are there atheist christmas carols? 
[0:16:11] premium mg42_: usedPray syadouPray
[0:16:14] Artacus: praying to bug jesus 
[0:16:21] premium hfredguy: dbjBallmer dbjBallmer dbjBallmer dbjBallmer dbjBallmer
[0:16:21] premium Syluxrox: w...what were those snails doing 
[0:16:21] bits-charity DICEDLEMMING: cant believe they made christmas religious 
[0:16:22] vip premium lmaoboat: Did jesus die to save these creatures souls, or was there a bug jesus? 
[0:16:25] Njack33: what bug would jesus be? 
[0:16:29] subscriber premium ThisIsNotAPlaceOfHonor: Clap
[0:16:32] subscriber snosa: Clap
[0:16:32] subscriber twitch-recap-2023 ocarina_boy: wideVIBE
[0:16:40] premium Syluxrox: @lmaoboat there was a bug jesus 
[0:16:40] vip artist-badge MagnetismMelodic: wow that was not that good 
[0:16:41] Artacus: a waterbug 
[0:16:42] IS0Moon: Was that it 
[0:16:48] Traedon: I both love and hate it, thanks 
[0:16:58] vip whette_fahrtz: Tommy needed 4 executives ooh la laaaa 
[0:17:05] Spie812: I liked the ants that sing 
[0:17:07] subscriber twitch-recap-2023 Gnatley: only one song, such restraint 
[0:17:08] subscriber twitch-recap-2023 n0tthedoctor: greats8Gongo
[0:17:09] subscriber sub-gifter explodes5: TOMMY NELSON: A sing of quality 
[0:17:09] Traedon: I'M SORRY 2004!?!? 
[0:17:13] subscriber sub-gifter explodes5: sign* 
[0:17:15] broadcaster turbo GreatSphynx: glue works 
[0:17:18] subscriber sub-gifter explodes5: 2004 holy shit 
[0:17:20] Artacus: God is a Bug 
[0:17:21] vip GodliestCat64: Hermie zzooTrip
[0:17:25] premium Syluxrox: A syadouNonderogatory christmas? 
[0:17:26] subscriber snosa: zzooTrip
[0:17:27] twitch-recap-2023 Annonn140: Gayge
[0:17:27] vip whette_fahrtz: more like sniffing glueworks 
[0:17:38] Artacus: pinecone christmas tree goes hard though 
[0:17:39] RDSk: Another year — another fruitcake 
[0:17:39] vip artist-badge MagnetismMelodic: these bugs should be asleep or dead 
[0:17:40] premium mg42_: A N T Z 
[0:17:42] vip GodliestCat64: I've only seen this fucking caterpillar around but never where he's from 
[0:17:44] vip Snudl: gondaL
[0:17:47] vip TheRealLupos: tendiAAH
[0:17:48] Origfx: hermie PLS 
[0:17:49] deworming_in_progress: i hate him already 
[0:17:51] broadcaster turbo GreatSphynx: there was like 3 seconds of him in kids klub 
[0:17:58] subscriber snosa: catPls
[0:17:58] vip GodliestCat64: THAT'S what it was 
[0:17:58] Origfx: catPls
[0:18:00] broadcaster turbo GreatSphynx: catPls catPls catPls
[0:18:01] IS0Moon: catPls
[0:18:01] Traedon: I... do not like this man DO NOT LIKE THESE LADS 
[0:18:03] vip artist-badge MagnetismMelodic: i feel like i've seen the caterpillar in a meme before though 
[0:18:04] vip GodliestCat64: catPls
[0:18:04] vip whette_fahrtz: catPls
[0:18:04] subscriber sub-gifter explodes5: Oh fuck its anothersong 
[0:18:05] subscriber premium ThisIsNotAPlaceOfHonor: catPls
[0:18:08] premium hfredguy: dbjRedmode dbjRedmode dbjRedmode dbjRedmode dbjRedmode
[0:18:08] subscriber kakabookake: tendiAAH
[0:18:09] premium Syluxrox: catPls
[0:18:09] twitch-recap-2023 wallacewellactually: they look like the ANTZ bugs 
[0:18:09] bigjetboy123: catPls
[0:18:11] vip whette_fahrtz: !ALLAMARAINE 
[0:18:11] moderator partner Nightbot: ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE ALLAMARAINE
[0:18:12] subscriber hunnietoots: catPls
[0:18:16] twitch-recap-2023 wallacewellactually: ie ugly 
[0:18:16] vip artist-badge MagnetismMelodic: the pinecone tree is kind of cute 
[0:18:16] subscriber KatalepsyKills: catPls
[0:18:19] Startex360: my church had these lads in the library 
[0:18:20] Solbiaa: Such gormless anthropomorphic faces 
[0:18:20] Origfx: Funnywhitecat5
[0:18:23] Traedon: I don't understand why EVERY SINGLE CHARACTER in this has Dreamworks face. 
[0:18:24] vip Trageenomical: gongo
[0:18:24] montrith: Fruitcake is just about the only gift these freaks deserve 
[0:18:26] Artacus: glad jack skellington didn't open the door to this world 
[0:18:33] vip TheRealLupos: MorshuPls So much to do, so much to see 
[0:18:36] subscriber sub-gifter maxzlock: rhyming away with away, nice 
[0:18:37] Spie812: its winter all you bugs should DIE 
[0:18:39] twitch-recap-2023 Fireborn: catPls
[0:18:40] Origfx: !catband 
[0:18:41] moderator partner Nightbot: catBoom CatGuitar catJAMGF DrumTime lilGoblin GuitarTime meow eGuitarTime popCat FluteTime catBoom catJAMM catJAMPARTY catJAMM catJAM
[0:18:44] whiteycorngood: so they ripped off the antz and bug's life design 
[0:18:48] subscriber hunnietoots: i forgot all about christmas fruit cake kaceyUhOh
[0:18:50] vip artist-badge MagnetismMelodic: and made them worse 
[0:18:54] subscriber superultracombo-2023 D_tector008: @TheTragicomical merry gongo mas 
[0:18:56] deworming_in_progress: is this that band vinny is obsessed with 
[0:18:59] Origfx: Funnywhitecat5
[0:18:59] deworming_in_progress: the beetles 
[0:19:01] subscriber snosa: yes 
[0:19:01] twitch-recap-2023 Annonn140: are these supposed to be Beatles? 
[0:19:04] Parsley3313: "it's better to give than to recieve" 
[0:19:04] vip Trageenomical: @D_tector008 it's all i ever wanted 
[0:19:04] nickegz: Merry Gongmas 
[0:19:06] vip artist-badge MagnetismMelodic: why the fucks are the snails like that 
[0:19:08] Artacus: funnywhitecat5 funnywhitecat5 funnywhitecat5
[0:19:09] twitch-recap-2023 BallTwistingWizard: Merry Christmas you freaks. 
[0:19:12] premium Syluxrox: wow I HATE that ant's moustache 
[0:19:19] subscriber sub-gifter explodes5: I saw "david lynch" for a second 
[0:19:20] Traedon: @purahblubber2005 Yeah. I hear it's called Red Vox 
[0:19:20] premium mg42_: merry fucking crimbo nerds 
[0:19:22] Spie812: catPls
[0:19:23] nickegz: + 
[0:19:25] CarrotCube: i hate all of these designs 
[0:19:28] subscriber snosa: tendiAAH
[0:19:29] subscriber hunnietoots: these names look familiar 
[0:19:32] Origfx: gachi scream? 
[0:19:34] vip GodliestCat64: @hunnietoots I recently learned that green cherries are a thing and that's what the green bits are in fruit cake dataBruh
[0:19:37] vip artist-badge MagnetismMelodic: NUT BOWLING 
[0:19:41] subscriber bits unspelld: @explodes5 dan lynch the forgotten lynch 
[0:19:43] vip TheRealLupos: BERMUS Nut Bowling 
[0:19:43] subscriber premium ThisIsNotAPlaceOfHonor: His favorite bug, Paul McCartbee 
[0:19:44] vip whette_fahrtz: Dear Santa, This year I have been a very good chatter. I would like one 24oz spray bottle of permethrin. thank you. widepeepoHappy
[0:19:44] Traedon: @CarrotCube I'm pretty sure we ALL do 
[0:19:46] montrith: You're bugs, everyone you knew last Christmas is dead 
[0:19:48] deworming_in_progress: nut bowling Uhhh i volunteer 
[0:19:48] subscriber hunnietoots: not the green cherries zzooTrip
[0:19:48] moderator premium play_dom_jot_human: Hello 
[0:19:50] RDSk: Have you seen that AI picture of The Beatles having a tea party? There were 5 Bealtes and none of them were John Lennon. daxMug
[0:19:52] subscriber snosa: hi
[0:19:59] premium Syluxrox: This is quite possibly the longest opening credits ive ever seen 
[0:20:02] vip artist-badge MagnetismMelodic: GORM
[0:20:06] Parsley3313: it's a bug's life 
[0:20:15] Artacus: spinal injury 
[0:20:19] twitch-recap-2023 Annonn140: watching all of this weird christmas gongo makes me happy i dont celebrate christmas 
[0:20:20] Artacus: permanent 
[0:20:20] twitch-recap-2023 BallTwistingWizard: This is A Bugs Purgatory 
[0:20:21] vip artist-badge MagnetismMelodic: why are these bugs pious 
[0:20:22] twitch-recap-2023 wallacewellactually: @RDSk thats joj and jej 
[0:20:22] Spie812: PERMANENT 
[0:20:25] vip GodliestCat64: Oh there's more 
[0:20:25] Origfx: i heard wilhelm 
[0:20:32] premium Syluxrox: hah 
[0:20:34] vip whette_fahrtz: siskoStare it’s still going 
[0:20:35] premium Syluxrox: that was kinda funny 
[0:20:40] Traedon: Oh good god, this is a full length movie, isn't it? 
[0:20:42] Origfx: catJAM
[0:20:46] Solbiaa: I mean, these bugs can survive winter, we should fear them 
[0:20:53] subscriber superultracombo-2023 D_tector008: @TheTragicomical these kuhntyy ladybugs 
[0:20:53] vip GodliestCat64: catPls
[0:20:54] premium Syluxrox: would 
[0:20:56] subscriber malty_meatia: Forgot about this sludge cartoon. Let's see what happens if I try to fall asleep to it 
[0:20:57] subscriber sub-gifter explodes5: are there male ladybugs? 
[0:20:59] Salty_peanut: what is happening 
[0:21:00] vip TheRealLupos: I FELL FOR HOURS 
[0:21:01] twitch-recap-2023 wallacewellactually: how long has this catepillar fuck been rolling down the hill 
[0:21:01] vip GodliestCat64: Tim Conway greats8YoTrip
[0:21:06] Origfx: Funnywhitecat5
[0:21:07] broadcaster turbo GreatSphynx: catPls
[0:21:07] subscriber premium ThisIsNotAPlaceOfHonor: Don Knotts wow 
[0:21:08] vip whette_fahrtz: DON KNOTTS OYOTrip
[0:21:08] subscriber overwatch-league-insider_1 Howoriginal: Don?! 
[0:21:10] twitch-recap-2023 BallTwistingWizard: Is the audio fucked for everyone or are my headphones busted 
[0:21:13] Traedon: I actually see some semblance of gags here. Things that could legit make me chuckle. 
[0:21:17] CarrotCube: @explodes5 no, this is christian cartoon 
[0:21:17] subscriber malty_meatia: Don knotts? 
[0:21:19] vip whette_fahrtz: ALLAMARAINE
[0:21:23] Origfx: @DarthJawa5 this is a pristine 5.1 mix 
[0:21:23] broadcaster turbo GreatSphynx: yeah there is like wered phasing 
[0:21:24] Traedon: I can only hope there will be more than one or two of them in this film 
[0:21:27] premium StoneCorbel: NotLikeThis
[0:21:30] Spie812: catJammingPolitely
[0:21:31] vip Snudl: catPls . o O ( TheVoices ) 
[0:21:41] vip whette_fahrtz: archerTrip
[0:21:42] twitch-recap-2023 wallacewellactually: yeah there's like no left audio balance LUL
[0:21:42] subscriber sub-gifter maxzlock: ??? elvis for some reason 
[0:21:43] premium Syluxrox: beelvis 
[0:21:47] subscriber premium ThisIsNotAPlaceOfHonor: Elvis Presbee 
[0:21:47] vip uforgot: atamYada o O ( PEPPERONI ) 
[0:21:48] premium mg42_: HEY POPS, DOES THIS THING WORK? 
[0:21:48] broadcaster turbo GreatSphynx: like the main audio is out of phase but the dialog isnt 
[0:21:49] mick_sq: ded 
[0:21:50] subscriber snosa: bubba 
[0:21:50] Parsley3313: BUSSEY 
[0:21:51] CarrotCube: elbees 
[0:21:52] subscriber sub-gifter explodes5: it is THE don knotts in the credits. 
[0:21:55] subscriber hunnietoots: christians love elvis 
[0:21:58] twitch-recap-2023 Annonn140: bussey 
[0:21:59] subscriber malty_meatia: Is the bee fonzi or elvis 
[0:22:01] vip artist-badge MagnetismMelodic: how is every single one of them so ugly 
[0:22:03] subscriber sub-gifter explodes5: Don Knotts is Wormie 
[0:22:03] RDSk: Bubba Bussy 
[0:22:04] subscriber snosa: jesusBeBallin
[0:22:06] broadcaster turbo GreatSphynx: Uhhh
[0:22:06] Origfx: i hate every single one of these faces 
[0:22:09] vip artist-badge MagnetismMelodic: they didn't get a single one right 
[0:22:10] subscriber sub-gifter maxzlock: you fucking moron 
[0:22:11] vip Trageenomical: @D_tector008 they are very glammed out 
[0:22:11] twitch-recap-2023 BallTwistingWizard: Idiot 
[0:22:15] nickegz: Wish Bugs life 
[0:22:17] vip whette_fahrtz: buhCat
[0:22:19] mick_sq: Must stomp. 
[0:22:20] subscriber bits unspelld: thats a frosty the snowman Reference 
[0:22:22] CarrotCube: humans? 
[0:22:22] bolonam: you absolute buffoon hermie 
[0:22:23] twitch-recap-2023 wallacewellactually: amish stickbugs 
[0:22:23] subscriber bits unspelld: uncultured chat 
[0:22:24] Traedon: @GreatSphynx Some kind of audio resonance thing? Most dialogue is stored in mono, isn't it? 
[0:22:29] subscriber premium ThisIsNotAPlaceOfHonor: D:
[0:22:29] subscriber snosa: odoLUL
[0:22:30] vip whette_fahrtz: de feet 
[0:22:35] Parsley3313: it's the turtle from Over the Hedge but as a caterpillar 
[0:22:36] premium mg42_: haHAA
[0:22:37] vip TheRealLupos: odoKEK
[0:22:38] twitch-recap-2023 Annonn140: odoLUL
[0:22:40] Origfx: TREKW
[0:22:42] Salty_peanut: odoLUL
[0:22:45] twitch-recap-2023 wallacewellactually: @parsleysoup THATS WHY THE DESIGN LOOKED SO FAMILIAR 
[0:22:46] subscriber hunnietoots: they have eyebrows OYOTrip
[0:23:02] Traedon: @parsleysoup Oh my god holy shit 
[0:23:11] premium Syluxrox: pulled those clipboards out of their ass 
[0:23:13] vip artist-badge MagnetismMelodic: your hydraulic legs should all be frozen in place 
[0:23:14] bits nyeaszel: holy shit is that SNOOP DOGG 
[0:23:21] Salty_peanut: true 
[0:23:22] RDSk: !cum 
[0:23:22] moderator partner Nightbot: Roiker MilkTime BERMUS MilkTime Roiker MilkTime
[0:23:23] subscriber superultracombo-2023 D_tector008: is that barnacle boy? 
[0:23:30] subscriber premium ThisIsNotAPlaceOfHonor: he's fine 
[0:23:39] nibblenippler: demons, the lot of them 
[0:23:39] Artacus: yes 
[0:23:42] subscriber sub-gifter maxzlock: oh my god it is barnacle boy 
[0:23:42] Artacus: that's barnacle boy 
[0:23:45] vip artist-badge MagnetismMelodic: you cannot say that 
[0:23:46] subscriber sub-gifter maxzlock: who was robin right 
[0:23:47] premium Syluxrox: humbugger is a slur 
[0:23:48] twitch-recap-2023 Annonn140: Buhh
[0:23:54] vip whette_fahrtz: KKona bah hamburger 
[0:23:58] deworming_in_progress: humb*g 
[0:24:04] vip GodliestCat64: Cock mansion 
[0:24:05] Salty_peanut: freddie flea is in massive debt 
[0:24:09] vip artist-badge MagnetismMelodic: you can say humbugga though 
[0:24:15] vip whette_fahrtz: cocksuck man-shun 
[0:24:18] Artacus: they are smart 
[0:24:23] premium mg42_: syadouOmegaLUL
[0:24:23] Artacus: they make ship go 
[0:24:26] bits nyeaszel: nicer? odoLUL
[0:24:27] vip artist-badge MagnetismMelodic: odoLUL
[0:24:27] subscriber hunnietoots: capitalists 
[0:24:29] Origfx: TREKW
[0:24:29] Salty_peanut: odoLUL
[0:24:30] vip GodliestCat64: odoLUL
[0:24:30] premium Syluxrox: syadouOmegaLUL
[0:24:33] premium Kasigil: why do these insects know about our lord and savior jesus christ 
[0:24:34] subscriber malty_meatia: I'd like an adult-sized Krabby Patty 
[0:24:35] vip artist-badge MagnetismMelodic: they look like diseased cock 
[0:24:37] subscriber turbo puppetself: Where's the king of the bees! 
[0:24:38] premium Syluxrox: syadouNonderogatory
[0:24:41] broadcaster turbo GreatSphynx: grannypiller is off her pills 
[0:24:46] CarrotCube: @Kasigil bug jesus 
[0:24:48] Artacus: they look like elderly glow worms 
[0:24:49] broadcaster turbo GreatSphynx: i hate how they walk 
[0:24:50] vip whette_fahrtz: I made a fruitcake this year 
[0:24:52] bits nyeaszel: she dry humping the ice zzooTrip
[0:24:56] subscriber hunnietoots: ya they walk weird 
[0:25:04] vip GodliestCat64: I've never had a fruitcake zzooTrip
[0:25:08] mick_sq: spynxSimp
[0:25:08] twitch-recap-2023 Annonn140: same this is kinda uncanny 
[0:25:08] premium Syluxrox: Oddjob hat 
[0:25:17] twitch-recap-2023 BallTwistingWizard: Why don't they just kill them? Are there bug cops preventing this? 
[0:25:17] Origfx: D:
[0:25:24] vip GodliestCat64: noBrien No food? 
[0:25:24] subscriber hunnietoots: id prefer a rum cake for christmas 
[0:25:26] broadcaster turbo GreatSphynx: wideHUH
[0:25:27] mick_sq: Nuh uh uh, you didn't say the magic word 
[0:25:31] bits nyeaszel: odoNo
[0:25:32] Origfx: odoNo
[0:25:35] vip whette_fahrtz: widepeepoSad
[0:25:38] vip GodliestCat64: Bleh
[0:25:41] premium Syluxrox: its....water..... 
[0:25:42] subscriber premium ThisIsNotAPlaceOfHonor: Supplah 
[0:25:46] twitch-recap-2023 BallTwistingWizard: Based the grind never stops 
[0:25:47] vip whette_fahrtz: KKona
[0:25:48] subscriber kakabookake: odoPain
[0:25:48] vip Snudl: Bleh
[0:25:49] subscriber malty_meatia: Ew, water 
[0:25:54] vip whette_fahrtz: quarkYea
[0:25:55] Salty_peanut: Based
[0:25:56] premium mg42_: Based
[0:25:58] Artacus: good saying 
[0:26:01] mick_sq: TREKW
[0:26:01] subscriber turbo puppetself: RAID the mansion Crunch
[0:26:02] premium Syluxrox: Based
[0:26:02] premium mg42_: jmikeKromegalul
[0:26:05] Salty_peanut: odoLUL
[0:26:05] premium Syluxrox: They aint wrong 
[0:26:06] Artacus: quarkYea
[0:26:10] subscriber hunnietoots: kaceyBOOBA
[0:26:14] twitch-recap-2023 wallacewellactually: fucked up bug capitalism 
[0:26:14] deworming_in_progress: anti-capitalist bug animation PogChamp
[0:26:21] subscriber premium ThisIsNotAPlaceOfHonor: Damn bug capitalism 
[0:26:21] subscriber snosa: ;)
[0:26:23] montrith: I hate all of these critters, but I have the capitalist bugs just a TAD more 
[0:26:25] vip TheRealLupos: He'll be naked by the end of the video 
[0:26:26] Origfx: ;)
[0:26:28] vip GodliestCat64: Based Freddy 
[0:26:35] subscriber malty_meatia: Seize the means of production, bugs 
[0:26:46] Origfx: odoNo assholes... 
[0:26:51] subscriber snosa: odoNo
[0:26:52] twitch-recap-2023 Annonn140: time for a christmas revolution 
[0:26:53] subscriber twitch-recap-2023 ocarina_boy: jmikeSadbungle
[0:26:55] vip afiddler: FeelsBadMan
[0:26:55] subscriber premium milesjacob: christ this is vile 
[0:26:57] twitch-recap-2023 wallacewellactually: because some bugs deserve to be burnt off the face of the planet. like potatobugs 
[0:26:57] Artacus: jesusBeBallin
[0:26:57] subscriber superultracombo-2023 D_tector008: @TheTragicomical mother bug 
[0:26:58] grandfatigue: Geepy
[0:26:59] Salty_peanut: jesus 
[0:27:00] Rooks_Castle: coxStare
[0:27:00] vip artist-badge Guardison: Please show a jesus bug 
[0:27:03] nickegz: duckyFace
[0:27:04] vip TheRealLupos: !god 
[0:27:04] moderator partner Nightbot: gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog
[0:27:04] vip artist-badge Guardison: please 
[0:27:05] subscriber snosa: jesusBeBallin
[0:27:05] premium Kasigil: WHAT
[0:27:05] montrith: Bug Jesus? 
[0:27:07] vip artist-badge Guardison: I'm begging 
[0:27:07] twitch-recap-2023 Fireborn: jesusBeBallin
[0:27:10] twitch-recap-2023 wallacewellactually: LADYBUG JESUS 
[0:27:10] subscriber hunnietoots: james and the giant peach spider haircut 
[0:27:11] bolonam: jesusBeBallin yuh 
[0:27:11] premium Kasigil: I DID NOT SEE THIS COMING 
[0:27:12] Solbiaa: CatDisplease
[0:27:13] subscriber snosa: w! jesusBeBallin
[0:27:13] premium mg42_: Fruitcake cornTasty
[0:27:14] vip afiddler: GerbShock
[0:27:15] premium Kasigil: WHAT THE FUCK DID I MISS 
[0:27:15] subscriber sub-gifter explodes5: jesusBeBallin
[0:27:15] DumboAKAwumbo: HUHH
[0:27:15] twitch-recap-2023 Blank_Dogton: BUG BIBLE 
[0:27:15] subscriber malty_meatia: Insect crucifixioin 
[0:27:17] Hoopy_Poopy: jesusBeBallin to check those ankles 
[0:27:18] Origfx: i hope its a praying mantis 
[0:27:19] Artacus: jesusBeBallin jesusBeBallin jesusBeBallin
[0:27:19] premium Syluxrox: jesus would be a bee so he could be called Beesus 
[0:27:20] twitch-recap-2023 BallTwistingWizard: Jesus saved us fuck wits, he had no deals with you bugs 
[0:27:24] superultracombo-2023 ultrahuhwhat: and fuck our women too 
[0:27:25] premium Kasigil: I THOUGHT THIS WAS A BUG'S LIFE 
[0:27:27] twitch-recap-2023 wallacewellactually: jesus came to ass on christmas? 
[0:27:28] premium mg42_: jesusSpin
[0:27:29] SageGhoul_: Jesus bugs 
[0:27:31] broadcaster turbo GreatSphynx: wideHUH
[0:27:32] mick_sq: tendiYea The true meaning of Christmas 
[0:27:32] vip artist-badge Guardison: WHAT
[0:27:33] premium LeBeauGringo: fruit cake that was a real knee slapper if i do says so myself . 
[0:27:33] grandfatigue: Jesus died for ladybug degeneracy 
[0:27:33] subscriber twitch-recap-2023 ocarina_boy: lmao 
[0:27:34] vip GodliestCat64: wideHUH
[0:27:34] twitch-recap-2023 Annonn140: WHAT
[0:27:34] premium Iceckryss: WHAT
[0:27:34] vip afiddler: monkaS
[0:27:34] Artacus: WHAT
[0:27:34] vip Snudl: Uhhh
[0:27:35] CarrotCube: HUHH
[0:27:35] premium Syluxrox: ??? DAMN 
[0:27:35] twitch-recap-2023 Fireborn: HUHH
[0:27:35] premium Kasigil: ok direct link to god 
[0:27:35] Origfx: HUHH
[0:27:35] subscriber twitch-recap-2023 Gnatley: WHAT
[0:27:35] vip premium lmaoboat: WHAT
[0:27:36] twitch-recap-2023 BallTwistingWizard: WHAT
[0:27:36] subscriber sub-gifter maxzlock: WHAT
[0:27:36] vip bits Jane_Inferno: HUHH
[0:27:36] twitch-recap-2023 wallacewellactually: WHAT
[0:27:37] vip TheRealLupos: greats8YoTrip
[0:27:37] subscriber premium KamiGousama: hello? 
[0:27:37] subscriber hunnietoots: zzooTrip
[0:27:37] Solbiaa: monkaS
[0:27:37] vip Trageenomical: it's him 
[0:27:37] subscriber kakabookake: lmaoooooooo 
[0:27:37] subscriber sub-gifter explodes5: WHAT
[0:27:38] premium nickynack: WHAT
[0:27:38] premium mg42_: REAL GOD??? 
[0:27:38] vip whette_fahrtz: Beezus jesusBeBallin
[0:27:38] subscriber snosa: zzooTrip god? 
[0:27:39] bolonam: HUHH WTF??? 
[0:27:39] twitch-recap-2023 Blank_Dogton: GOD 
[0:27:39] whiteycorngood: lmao 
[0:27:39] montrith: lol 
[0:27:40] vip GodliestCat64: Wtf 
[0:27:40] vip artist-badge Guardison: WHAT IT'S THAT EASY? 
[0:27:41] subscriber bits unspelld: WHAT
[0:27:41] Artacus: EXCUSE ME 
[0:27:41] subscriber premium ThisIsNotAPlaceOfHonor: wideHUH
[0:27:42] deworming_in_progress: WHAT GOD CAMEO???? 
[0:27:42] StandBackson: WHAT
[0:27:42] premium Syluxrox: DIRECT LINE TO GOD???? 
[0:27:42] Parsley3313: even bugs 
[0:27:42] subscriber snosa: so much 
[0:27:43] grandfatigue: <3
[0:27:43] SageGhoul_: LOLLL 
[0:27:44] squeejam: Uhhh
[0:27:44] subscriber sub-gifter explodes5: HOLY FUCK 
[0:27:45] premium Kasigil: I am sent 
[0:27:45] subscriber partner Temiree: BUG GOD 
[0:27:46] broadcaster turbo GreatSphynx: god is just a bug gooner 
[0:27:48] Hoopy_Poopy: WHAT AI GOD 
[0:27:48] subscriber KatalepsyKills: God? 
[0:27:49] Origfx: zzooTrip ...... 
[0:27:50] twitch-recap-2023 Annonn140: WHAT REAL GOD 
[0:27:51] subscriber KatalepsyKills: woah 
[0:27:52] vip whette_fahrtz: zzooTrip gawd 
[0:27:53] premium nickynack: bros got god on speed dial 
[0:27:55] subscriber sub-gifter explodes5: How did they cast God for this role? 
[0:27:56] Rooks_Castle: @GreatSphynx HUHH
[0:27:58] Origfx: casual god convo 
[0:27:59] vip Trageenomical: @D_tector008 she truly is mother 
[0:28:00] RDSk: Bug Jesus was splattered 
[0:28:02] subscriber premium KamiGousama: he's easvdropping? 
[0:28:02] vip premium lmaoboat: These ladybugs are higher up than the pope 
[0:28:04] SageGhoul_: *him* 
[0:28:05] subscriber hunnietoots: i tried this once zzooTrip it didnt work 
[0:28:06] subscriber snosa: littering 
[0:28:07] twitch-recap-2023 BallTwistingWizard: You need food morons 
[0:28:07] mick_sq: Yo God dawg 
[0:28:10] Parsley3313: @GreatSphynx HUHH
[0:28:10] montrith: So bugs have a straight line to God but humans don't 
[0:28:10] Solbiaa: Yup, you don't need food 
[0:28:11] subscriber twitch-recap-2023 Gnatley: ladybugs, gods chosen 
[0:28:11] Artacus: special appeance by GOD 
[0:28:14] Origfx: ????????? 
[0:28:17] subscriber malty_meatia: "We have the Bug's Life at home" 
[0:28:21] grandfatigue: God feels so misunderstood 
[0:28:23] broadcaster turbo GreatSphynx: its because they only live 21 days 
[0:28:26] subscriber sub-gifter explodes5: Starring: God, as Himself greats8ZooTrip
[0:28:26] StandBackson: mst3kRobichet I love christmas. 
[0:28:29] subscriber snosa: oh
[0:28:30] subscriber partner Temiree: temireGrandma ? 
[0:28:35] subscriber hunnietoots: not 21 days monkaS
[0:28:40] vip whette_fahrtz: peepoHappy
[0:28:41] CarrotCube: granmd caterpillar? 
[0:28:42] subscriber snosa: yes 21 days 
[0:28:43] vip artist-badge Guardison: OYOTrip
[0:28:43] SageGhoul_: Grannypillar 
[0:28:43] subscriber twitch-recap-2023 ocarina_boy: yayayayayya 
[0:28:44] vip GodliestCat64: Lmao 
[0:28:44] grumzirg: aaa 
[0:28:44] vip premium plorf: yayaya 
[0:28:45] DumboAKAwumbo: Crunch
[0:28:47] vip artist-badge Guardison: OYOTrip YUMMY 
[0:28:48] subscriber twitch-recap-2023 Gnatley: boy you are a caterpillar you are still a kid 
[0:28:49] subscriber partner Temiree: hyenaStare
[0:28:50] Solbiaa: Feeder? 
[0:28:50] bigjetboy123: peepoHappy
[0:28:50] superultracombo-2023 ultrahuhwhat: chewLes
[0:28:51] twitch-recap-2023 Annonn140: veryCat
[0:28:51] vip premium plorf: veryCat
[0:28:51] Origfx: monkaS
[0:28:52] vip GodliestCat64: Crunch
[0:28:52] twitch-recap-2023 wallacewellactually: I hate this 
[0:28:54] Artacus: chewLes
[0:28:55] vip whette_fahrtz: chewLes
[0:28:57] vip TheRealLupos: chewLes Mmm, food 
[0:28:57] subscriber twitch-recap-2023 ocarina_boy: gluttony 
[0:28:58] Salty_peanut: gluttony. wormie is going to hell 
[0:28:58] premium Iceckryss: FAT FUCK 
[0:28:58] vip premium plorf: Tasty
[0:28:58] subscriber malty_meatia: Why don't they become butterflies 
[0:28:59] subscriber superultracombo-2023 D_tector008: force feeding 
[0:28:59] twitch-recap-2023 wallacewellactually: NO 
[0:28:59] nickegz: Shrek iis love 
[0:29:00] StandBackson: ffs 
[0:29:01] twitch-recap-2023 wallacewellactually: STOP THAT
[0:29:01] vip artist-badge Guardison: fetish cartoon 
[0:29:01] subscriber snosa: lol 
[0:29:03] RDSk: vore 
[0:29:03] SageGhoul_: This was only a week before 
[0:29:04] subscriber premium ThisIsNotAPlaceOfHonor: Grannypiller's cream pies 
[0:29:04] Origfx: WHAT
[0:29:04] premium giant_robots: fetish image 
[0:29:05] twitch-recap-2023 Annonn140: wait how is there a granny catepillar? 
[0:29:07] premium Syluxrox: bruh... 
[0:29:08] vip GodliestCat64: Lady you threw them at him 
[0:29:09] Parsley3313: manipulated fetish image 
[0:29:11] mick_sq: 🐛 🔫 RikerStare
[0:29:15] vip TheRealLupos: Tags: weight gain 
[0:29:16] vip whette_fahrtz: blorbed up 
[0:29:17] subscriber hunnietoots: why no butterfly 
[0:29:18] Solbiaa: That's just child abuse 
[0:29:18] Traedon: manipulated fetish image 
[0:29:20] vip GodliestCat64: Fruit cake zzooTrip
[0:29:21] glhf-pledge Sir_Nicolas: granny fruit cake 
[0:29:22] subscriber superultracombo-2023 D_tector008: people call me fruit cake 
[0:29:26] twitch-recap-2023 Annonn140: they are supposed to turn into butterflies, makes you think 
[0:29:29] premium Syluxrox: Is this Glibglobgabgalab origin story? 
[0:29:31] vip Trageenomical: is that bug okay 
[0:29:39] subscriber superultracombo-2023 D_tector008: @TheTragicomical none of them are ok 
[0:29:41] StandBackson: Slither (2006) 
[0:29:43] Dust1210: catPls
[0:29:43] vip whette_fahrtz: catPls
[0:29:43] subscriber snosa: catPls
[0:29:44] subscriber hunnietoots: ab day 
[0:29:45] premium giant_robots: kermiePls
[0:29:49] RDSk: Wormy got the dumpe 
[0:29:49] Origfx: jarJAM
[0:29:50] bigjetboy123: catPls
[0:29:50] StandBackson: catPls
[0:29:52] premium mg42_: those look like very long nipples sprouting from their underside, that they're walking with 
[0:29:53] bits nyeaszel: catPls
[0:29:54] Solbiaa: catPls
[0:29:56] Salty_peanut: famine 
[0:29:56] subscriber KatalepsyKills: catPls
[0:29:57] vip whette_fahrtz: odoAWOOGA
[0:29:57] SageGhoul_: catPls
[0:29:57] vip GodliestCat64: Crunch
[0:29:58] subscriber malty_meatia: I hate all of their faces 
[0:30:00] vip Trageenomical: @D_tector008 so true 
[0:30:00] grumzirg: god the way the move, its just 
[0:30:05] Origfx: TREKW get fucked 
[0:30:12] Parsley3313: why was that one blindfolded? 
[0:30:15] immunomics: this is fucking disgusting 
[0:30:19] twitch-recap-2023 wallacewellactually: @mg42_ how do we know they arent that 
[0:30:19] Salty_peanut: they are the Beatles 
[0:30:24] twitch-recap-2023 Annonn140: maybe the creators dont understand the connection between the catepillar and butterfly, wouldn't be surprised 
[0:30:25] subscriber sub-gifter explodes5: If they wanted food they should've just worked harder 
[0:30:29] subscriber twitch-recap-2023 ocarina_boy: the stinkhouse 
[0:30:30] CarrotCube: eat the house!! 
[0:30:30] twitch-recap-2023 wallacewellactually: granny pillar is DEAD 
[0:30:33] mick_sq: ALL of these bugs deserve to go extinct 
[0:30:34] StandBackson: ALL YOU NEED IS CASH 
[0:30:41] subscriber sub-gifter explodes5: \s 
[0:30:43] Artacus: she's 90 days old 
[0:30:43] subscriber twitch-recap-2023 Gnatley: grannypillars house could feed the whole town 
[0:30:44] Salty_peanut: simply mob the rich bugs' mansion and overpower their security 
[0:30:45] vip uforgot: kermiePls
[0:30:47] subscriber malty_meatia: The miracle of metamorphus 
[0:30:47] premium goldwolf128: im late what movie is this 
[0:30:49] grandfatigue: hodor 
[0:30:49] premium Iceckryss: idiot 
[0:30:51] subscriber solberserker: Grannypiller is fucking hot 
[0:30:53] Origfx: she didnt age at all 
[0:30:55] subscriber partner Temiree: how is grannypillar not a butterfly yet 
[0:30:59] immunomics: you don't have ears 
[0:31:03] Artacus: she reached max level 
[0:31:03] premium giant_robots: they all look like the Critic 
[0:31:04] subscriber hunnietoots: paula deenpillar 
[0:31:06] premium goldwolf128: ok 
[0:31:07] premium goldwolf128: thx 
[0:31:08] Traedon: @Temiree Butterflies are a different species :)
[0:31:09] vip TheRealLupos: Honestly, what is stopping all those bugs from storming into the cockroaches' house and taking the food? 
[0:31:09] subscriber premium ThisIsNotAPlaceOfHonor: She's almost 100 days old, on the verge of death 
[0:31:11] twitch-recap-2023 Annonn140: i dont think creators understand how catepillars work 
[0:31:13] premium LeBeauGringo: i will bust a nut for you granny don't worry ! 
[0:31:13] bits nyeaszel: gondaL ILF 
[0:31:14] Artacus: sherman the wormman 
[0:31:19] vip whette_fahrtz: no NUT Roiker
[0:31:20] bigjetboy123: D:
[0:31:20] subscriber malty_meatia: @hunnietoots Beat me to it 
[0:31:25] subscriber twitch-recap-2023 ocarina_boy: greats8YoTrip
[0:31:25] twitch-recap-2023 wallacewellactually: fruitcake.wav 
[0:31:26] vip GodliestCat64: greats8YoTrip
[0:31:26] vip TheRealLupos: greats8YoTrip
[0:31:29] StandBackson: greats8YoTrip
[0:31:29] CarrotCube: LUL
[0:31:31] subscriber hunnietoots: OYOTrip
[0:31:33] subscriber sofasofia: greats8YoTrip
[0:31:34] immunomics: no EARS no EARMUFFS 
[0:31:37] Salty_peanut: fruit cake is nasty 
[0:31:38] Startex360: :)
[0:31:39] SageGhoul_: Ive never seen a fruitcake in person 
[0:31:40] broadcaster turbo GreatSphynx: sassy fruit cake march 
[0:31:42] subscriber partner Temiree: greats8YoTrip
[0:31:47] subscriber hunnietoots: ALLAMARAINE
[0:31:48] subscriber partner Temiree: @Traedon oh :)
[0:31:48] subscriber malty_meatia: (Antz theme plays) 
[0:32:01] Artacus: ALLAMARAINE
[0:32:02] Solbiaa: :)
[0:32:06] twitch-recap-2023 BallTwistingWizard: STOP SAYING THAT
[0:32:08] Artacus: bugger? that's a swear 
[0:32:10] subscriber solberserker: Chat what did he say??? 
[0:32:11] premium Syluxrox: they said the slur again.... syadouCry
[0:32:11] subscriber twitch-recap-2023 ocarina_boy: stop saying that lmaooo 
[0:32:11] subscriber twitch-recap-2023 Gnatley: another hard r 
[0:32:14] subscriber premium ThisIsNotAPlaceOfHonor: Bug slur 
[0:32:15] subscriber snosa: ALLAMARAINE
[0:32:17] subscriber sub-gifter explodes5: The animation for this was so state-of-the-art that it took almost 30 minutes to render it all 
[0:32:20] vip TheRealLupos: odokiss
[0:32:23] subscriber solberserker: did my man drop a hard R??? 
[0:32:23] sub-gift-leader divind95: why am i watching ants zzooTrip
[0:32:23] subscriber hunnietoots: ALLAMARAINE 🥮 ALLAMARAINE 🥮 ALLAMARAINE 🥮 
[0:32:23] premium Iceckryss: DEAD 
[0:32:25] broadcaster turbo GreatSphynx: wideHUH
[0:32:26] subscriber snosa: odokiss
[0:32:27] vip GodliestCat64: dataBruh
[0:32:28] twitch-recap-2023 wallacewellactually: dead 
[0:32:28] subscriber twitch-recap-2023 ocarina_boy: deadass
[0:32:28] Origfx: ded 
[0:32:28] subscriber sofasofia: o7
[0:32:30] SageGhoul_: D:
[0:32:31] deworming_in_progress: FISHWAR
[0:32:32] Duckiestrides: wh 
[0:32:35] vip twitch-recap-2023 viahate: rubrDed
[0:32:40] twitch-recap-2023 wallacewellactually: fruitcake GONE 
[0:32:40] subscriber twitch-recap-2023 ocarina_boy: tendiAAH
[0:32:41] subscriber premium ThisIsNotAPlaceOfHonor: ALERTA
[0:32:41] Artacus: WHAT
[0:32:42] RDSk: Humbugger? I hardly know 'er! odoLUL
[0:32:42] twitch-recap-2023 Annonn140: ALERTA
[0:32:43] vip bits Jane_Inferno: ALERTA
[0:32:43] subscriber JoGoBeans: gongo OYOTrip
[0:32:44] subscriber solberserker: ALERTA
[0:32:44] vip whette_fahrtz: odoSeethe theyre not dead 
[0:32:44] mick_sq: WOAW 
[0:32:44] twitch-recap-2023 BallTwistingWizard: ALERTA
[0:32:44] subscriber snosa: tendiAAH
[0:32:45] StandBackson: ALERTA
[0:32:47] SageGhoul_: abando33Diosmio
[0:32:47] Origfx: NOOOO
[0:32:49] deworming_in_progress: fuck i thought that was my cat 
[0:32:51] sub-gift-leader divind95: This isn't a Bug's Life. Or Ants. HUHH
[0:32:52] subscriber twitch-recap-2023 ocarina_boy: NOOOO
[0:32:55] subscriber malty_meatia: It was the Grinch, dinguses 
[0:33:01] subscriber hunnietoots: it was very mewish 
[0:33:02] subscriber sub-gifter explodes5: dollar store antz 
[0:33:04] bits nyeaszel: la cucuaranch 
[0:33:04] montrith: They want the fruit cake? That IS greedy 
[0:33:05] Artacus: GerbShock
[0:33:08] premium Cornjeebus: Hmmmm 
[0:33:12] subscriber sub-gifter maxzlock: i hate his eyelashes 
[0:33:14] subscriber malty_meatia: Grinch 
[0:33:16] bigjetboy123: the grinch 
[0:33:17] Salty_peanut: eat the rich 
[0:33:23] Artacus: yeah "talk" 
[0:33:24] sub-gift-leader divind95: I hate CG bugs 
[0:33:27] subscriber sub-gifter explodes5: Tasty
[0:33:30] premium Iceckryss: same 
[0:33:32] premium Syluxrox: Based
[0:33:35] subscriber twitch-recap-2023 ocarina_boy: sounds like a job for starfleet picBust
[0:33:36] subscriber premium ThisIsNotAPlaceOfHonor: voteYea 
[0:33:37] bigjetboy123: D:
[0:33:38] subscriber malty_meatia: I nominate the Grinch 
[0:33:41] vip GodliestCat64: Fruit cake NOOOO
[0:33:44] subscriber hunnietoots: why not cut the fruitcake so everynoe has some zzooTrip
[0:33:48] bits nyeaszel: Grand Nagus?? 
[0:33:48] vip Snudl: I love democracy 
[0:33:52] StandBackson: THE SYSTEM HAS FAILED 
[0:33:53] subscriber twitch-recap-2023 Gnatley: big boy bluff 
[0:33:58] vip TheRealLupos: @ocarina_boy picBust PhaserTime 🪳 
[0:34:06] vip GodliestCat64: @hunnietoots Because the roaches want the whole thing odoNo
[0:34:13] RDSk: This is it Luigi 
[0:34:19] subscriber snosa: odoLUL
[0:34:20] vip TheRealLupos: TREKW
[0:34:23] subscriber JoGoBeans: is this ANTZ 
[0:34:23] subscriber hunnietoots: aur naur odoNo
[0:34:24] Origfx: OMEGALUL 
[0:34:24] vip GodliestCat64: lmao 
[0:34:27] StandBackson: YOU BRING A LIGHT? 
[0:34:27] RDSk: worfLUL
[0:34:28] sub-gift-leader divind95: DrumTime
[0:34:33] subscriber twitch-recap-2023 ocarina_boy: HYPERDRUMTIME
[0:34:35] premium Syluxrox: syadouOmegaLUL
[0:34:36] subscriber sub-gifter explodes5: @JoGo_ is the squeekquel 
[0:34:42] bits nyeaszel: odoLUL
[0:34:42] subscriber JoGoBeans: @explodes5 OYOTrip
[0:34:44] Origfx: Based antonio 
[0:34:44] RDSk: Pepechill DrumTime <— drumming with his feet 
[0:34:56] vip whette_fahrtz: SODA 
[0:34:58] subscriber JoGoBeans: wait that's the turtle from Over the Hedge 
[0:35:01] subscriber superultracombo-2023 D_tector008: those roaches are fucking, you cant tell me they arent 
[0:35:02] Origfx: Stare
[0:35:05] Startex360: YOU CAN'T 
[0:35:06] premium Syluxrox: You cant just say perchance 
[0:35:07] subscriber premium ThisIsNotAPlaceOfHonor: You can't just say perchance 
[0:35:10] montrith: Why so polite? Just form a mob and raid this house! 
[0:35:15] bits nyeaszel: p e r c h a n c e 
[0:35:20] mick_sq: Who else rooting for all of them to starve? 
[0:35:29] Salty_peanut: odoLUL
[0:35:30] sub-gift-leader divind95: odoLUL
[0:35:30] twitch-recap-2023 BallTwistingWizard: You can't pull the race card you've been saying humbugger all movie 
[0:35:32] twitch-recap-2023 Annonn140: odoLUL
[0:35:34] subscriber malty_meatia: Why don't them roaches have antennae 
[0:35:35] subscriber hunnietoots: rooting for a small forest fire 
[0:35:36] bits nyeaszel: odoLUL
[0:35:40] subscriber twitch-recap-2023 ocarina_boy: !frasier 
[0:35:41] moderator partner Nightbot: odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap
[0:35:56] sub-gift-leader divind95: home invasion time 
[0:36:03] Salty_peanut: what 
[0:36:04] mick_sq: dataPong
[0:36:08] sub-gift-leader divind95: wideHUH
[0:36:08] vip TheRealLupos: Roiker
[0:36:09] subscriber superultracombo-2023 D_tector008: ooh gurl 
[0:36:09] subscriber premium ThisIsNotAPlaceOfHonor: THICC 
[0:36:10] Parsley3313: a poop 
[0:36:10] vip afiddler: BERMAN
[0:36:10] bits nyeaszel: he wore the ame hat zzooTrip
[0:36:11] twitch-recap-2023 Annonn140: BERMUS
[0:36:11] bigjetboy123: Kreygasm
[0:36:11] subscriber sub-gifter maxzlock: HUHH
[0:36:11] subscriber JoGoBeans: BERMUS
[0:36:13] Artacus: HUHH
[0:36:15] subscriber hunnietoots: BERMUS
[0:36:16] bits nyeaszel: BERMUS
[0:36:17] Salty_peanut: dead 
[0:36:20] Bladestorm01: DED 
[0:36:20] subscriber snosa: BERMUS
[0:36:23] StandBackson: BERMUS
[0:36:23] premium mg42_: haHAA
[0:36:34] Salty_peanut: burn their mansion to the ground 
[0:36:40] twitch-recap-2023 franceybear: what kinda plan LUL
[0:36:45] subscriber superultracombo-2023 D_tector008: waterboarding 
[0:36:46] bits nyeaszel: monkaS
[0:36:47] subscriber twitch-recap-2023 ocarina_boy: tendiAAH
[0:36:49] twitch-recap-2023 Annonn140: ded 
[0:36:49] Origfx: TREKW
[0:36:49] subscriber superultracombo-2023 D_tector008: oh
[0:36:49] Artacus: dead 
[0:36:50] subscriber premium ThisIsNotAPlaceOfHonor: Holy shit 
[0:36:56] vip uforgot: Wowee
[0:36:58] whiteycorngood: stop laughing 
[0:36:58] twitch-recap-2023 wallacewellactually: why dont they just kill the cockroaches. they vastly outnumber them 
[0:37:01] sub-gift-leader divind95: they're losing odoLUL
[0:37:17] twitch-recap-2023 Annonn140: yeah dont you have an ant military, just kill them at this point 
[0:37:20] subscriber premium ThisIsNotAPlaceOfHonor: Cockroaches can survive nuclear blasts 
[0:37:27] Artacus: jaboodyWow
[0:37:29] Salty_peanut: Stare
[0:37:32] bigjetboy123: Stare
[0:37:33] subscriber superultracombo-2023 D_tector008: @SergeantJohnLuigi but can they survive BULLET 
[0:37:38] twitch-recap-2023 NastyRedX: Stare
[0:37:41] mick_sq: @SergeantJohnLuigi They can't survive my sole tho 
[0:37:42] bits nyeaszel: baguettes 
[0:37:43] Origfx: baguettes? 
[0:37:43] sub-gift-leader divind95: baguette 
[0:37:45] CarrotCube: buggettes??? 
[0:37:45] Hoopy_Poopy: bugs and baguettes 
[0:37:47] subscriber superultracombo-2023 D_tector008: She is mothering 
[0:37:52] Bladestorm01: they survive radiation not the blast LUL
[0:37:53] glitchcon2020 DeadheadJackal: This is interesting and all but what are these insect's views on organized religion 
[0:37:54] subscriber malty_meatia: Ugh I forgot about the short era of "... Oooookaaaayyyy" being passed off as a joke 
[0:37:56] RDSk: Milf 
[0:38:00] subscriber snosa: milf 
[0:38:01] glitchcon2020 Lyzerus: Dead 
[0:38:02] vip TheRealLupos: ded 
[0:38:11] twitch-recap-2023 Annonn140: that the cockroach elites takes all the food and the majority cant do anything about it says a lot about society 
[0:38:22] Artacus: because he's don knotts 
[0:38:25] superultracombo-2023 ultvir: KEKWPoint 
[0:38:28] superultracombo-2023 ultrahuhwhat: f r u i t c a k e 
[0:38:37] bits nyeaszel: crotchy 
[0:38:40] twitch-recap-2023 Fireborn: odoLUL 🫵 
[0:38:44] Duckiestrides: keenan and kel 
[0:38:47] subscriber sub-gifter explodes5: meta tho 
[0:38:48] sub-gift-leader divind95: lmao 
[0:38:48] Salty_peanut: odoLUL
[0:38:49] Parsley3313: @Annonn140 Elites, huh? I'm glad I wasn't the only one thinking it 
[0:38:51] montrith: for dudes who didn't know anything about Christmas they sure do know a lot about Christmas 
[0:39:06] bits nyeaszel: !god 
[0:39:06] moderator partner Nightbot: gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog
[0:39:07] sub-gift-leader divind95: jesusBeBallin
[0:39:07] twitch-recap-2023 Annonn140: i mean, they are even wearing top hats 
[0:39:08] subscriber sub-gifter explodes5: PRAY FOR BUG MURDER 
[0:39:09] subscriber snosa: hey 
[0:39:09] Rooks_Castle: O lord smite them pls 
[0:39:09] holykrawp: Tim Conway? 
[0:39:09] vip GodliestCat64: Lmao 
[0:39:10] subscriber JoGoBeans: oh okay 
[0:39:11] vip artist-badge Guardison: They can just...do that 
[0:39:11] Origfx: HUHH
[0:39:12] glitchcon2020 Lyzerus: God pogonaWow
[0:39:12] Traedon: UM LUL
[0:39:16] premium Syluxrox: bugs have a fucking direct line to god 
[0:39:16] Salty_peanut: holy shit 
[0:39:16] subscriber partner Temiree: greats8YoTrip
[0:39:18] Origfx: just ask god to smite them 
[0:39:19] twitch-recap-2023 Annonn140: WHAT GOD 
[0:39:21] Traedon: HUHH
[0:39:21] vip GodliestCat64: God answers the calls of bugs above all else I guess 
[0:39:23] vip whette_fahrtz: archerTrip hello everyone 
[0:39:24] grumzirg: gob 
[0:39:25] twitch-recap-2023 franceybear: WHAT
[0:39:26] twitch-recap-2023 wallacewellactually: THEYRE GOING TO STARVE, GOD 
[0:39:28] twitch-recap-2023 BallTwistingWizard: The bugs have a higher god priority than I do 
[0:39:30] premium Syluxrox: God theyre going to fucking STARVE 
[0:39:31] subscriber malty_meatia: GOD, GRANT MY WISH! 
[0:39:31] cherrrybomb567: LUL
[0:39:32] subscriber snosa: they're hungry god 
[0:39:33] twitch-recap-2023 BallTwistingWizard: What the fuck man 
[0:39:34] sub-gift-leader divind95: I missed half of this was god like...mentioned ANY time before this? 
[0:39:35] Parsley3313: It says a lot that God talks to bugs but not us 
[0:39:38] broadcaster turbo GreatSphynx: god is a bug 
[0:39:39] vip twitch-recap-2023 viahate: crumpPray
[0:39:39] Origfx: cheesus 
[0:39:40] Bladestorm01: GOD THERE ARE GOING TO DIE 
[0:39:40] mick_sq: @GodliestCat64 No wonder they outnumber us for that much. 
[0:39:40] bits nyeaszel: jesusSpin
[0:39:41] subscriber twitch-recap-2023 Gnatley: "youre gonna starve, but jesus" 
[0:39:47] Duckiestrides: CHEEZUS ? 
[0:39:48] vip TheRealLupos: the reason God doesn't talk to us anymore is because he's busy talking to bugs 
[0:39:49] subscriber twitch-recap-2023 carlysle_: god, are you going to let us starve? 
[0:39:50] Salty_peanut: you have forgotten, and now you will be punished 
[0:39:51] vip Snudl: gerbPog Waow 
[0:39:53] subscriber malty_meatia: Bug and small 
[0:39:55] Traedon: God is just constantly watching over them because they're in a terrarrium 
[0:39:56] Origfx: zzooTrip
[0:39:56] twitch-recap-2023 Annonn140: gerbPog
[0:39:57] subscriber premium milesjacob: this somehow seems... inauthentic 
[0:39:58] 22seff22: Do only bugs go to heaven? 
[0:40:01] twitch-recap-2023 BallTwistingWizard: Morons you're going to starve 
[0:40:01] subscriber sub-gifter explodes5: "Thanks for the gift god but did you bring a reciept? " 
[0:40:02] premium sigmacatboy: god talks in audio frequencies only bugs can hear 
[0:40:03] vip GodliestCat64: gondaL calls to god 
[0:40:05] Duckiestrides: cant have it woithout CHEEZUS 
[0:40:06] subscriber twitch-recap-2023 carlysle_: who needs food when you have jesus 
[0:40:06] superultracombo-2023 ultrahuhwhat: cheese us 
[0:40:08] subscriber snosa: they eat jesus at church 
[0:40:10] twitch-recap-2023 Fireborn: odoSoyL jesusSpin
[0:40:10] subscriber sofasofia: henemiAngle
[0:40:11] subscriber kakabookake: fruitcake = jesus? im freaking out 
[0:40:12] subscriber premium ThisIsNotAPlaceOfHonor: Can't celebrate when you're dead 
[0:40:19] MetallicUmbrage: is bug jesus named beesus 
[0:40:19] immunomics: snails aren't fuckin bugs 
[0:40:20] subscriber twitch-recap-2023 n0tthedoctor: @divind95 yeah God spoke to the bugs at least once prior to this 
[0:40:21] glhtacos: Well the spider won't be hungry if you know what I mean 
[0:40:21] Bladestorm01: I'm guessing that Peewee got it LUL
[0:40:28] deworming_in_progress: bugs being grateful for jesus' wish implies bugs can commit sins 
[0:40:28] Origfx: odoNo just a crumb.... 
[0:40:31] subscriber sub-gifter explodes5: who ever said "paula dinapillar" thank you 
[0:40:32] superultracombo-2023 ultrahuhwhat: drizzle some melted mozarella on that fruitcake 
[0:40:38] premium mg42_: old fruitcake cornTasty
[0:40:40] subscriber premium milesjacob: bugs are born to sin 
[0:40:44] subscriber sub-gifter explodes5: did I just hear a bug fart 
[0:40:50] Parsley3313: @MetallicUmbrage Beesus and Bughead 
[0:40:50] Artacus: jaboodyPray
[0:40:51] subscriber malty_meatia: Butter n ohhl 
[0:40:53] subscriber partner Temiree: temireYum
[0:40:53] Bladestorm01: that's a lie its spoiled very slowly 
[0:40:54] twitch-recap-2023 IkiruToLive: ty bug god for gongmas 
[0:40:57] salad_snack_: thank you GOD you're the best 
[0:41:00] superultracombo-2023 ultvir: "if stored properly, fruitcake can have a shelf life of a few months" 
[0:41:01] premium cosmonaughtbob: jesusSpin
[0:41:03] MetallicUmbrage: @parsleysoup so true 
[0:41:03] Artacus: abug 
[0:41:04] vip TheRealLupos: chewLes
[0:41:04] Traedon: @parsleysoup Thanks, I hate it 
[0:41:05] Origfx: those portions make no sense 
[0:41:10] glitchcon2020 Lyzerus: mmm dog food. 
[0:41:10] bits nyeaszel: chewLes
[0:41:14] immunomics: Oh I hate it 
[0:41:15] premium cosmonaughtbob: Randy Newman rip off 
[0:41:15] game-developer thepsynergist2: D: cockroaches 
[0:41:16] subscriber twitch-recap-2023 n0tthedoctor: greats8OTrip
[0:41:16] vip twitch-recap-2023 viahate: Crunch
[0:41:17] Salty_peanut: no 
[0:41:17] subscriber malty_meatia: (Stock biting sounds) 
[0:41:17] twitch-recap-2023 BallTwistingWizard: No? 
[0:41:19] vip TheRealLupos: Nah, fuck them 
[0:41:20] bits nyeaszel: BERMAD NO 
[0:41:21] subscriber JoGoBeans: NO 
[0:41:22] superultracombo-2023 ultrahuhwhat: chewLes
[0:41:23] subscriber partner Temiree: greats8Ytrip
[0:41:24] vip Trageenomical: NAH 
[0:41:26] Bladestorm01: NO THEY HAVE SOME 
[0:41:26] twitch-recap-2023 IkiruToLive: DONT DO IT 
[0:41:26] sub-gift-leader divind95: fuck em odoLUL
[0:41:28] Salty_peanut: shut he fuck up 
[0:41:31] Origfx: FOOLS 
[0:41:32] premium mg42_: odoNo
[0:41:32] subscriber twitch-recap-2023 carlysle_: BERMAD SHUT UP 
[0:41:35] Bladestorm01: fuck em 
[0:41:45] premium cosmonaughtbob: carlPls too busy 
[0:41:50] Salty_peanut: Based
[0:41:52] broadcaster turbo GreatSphynx: those fuckin lady bugs ate it 
[0:41:55] superultracombo-2023 ultrahuhwhat: plus they're atheist 
[0:41:57] bits nyeaszel: this guy is full of spite 
[0:41:59] vip TheRealLupos: Ladybugs are SUS 
[0:42:02] Artacus: ONLY GOD MAY JUDGE THEM 
[0:42:10] bits nyeaszel: monkaS
[0:42:13] game-developer thepsynergist2: they have a mcmansion 
[0:42:14] vip GodliestCat64: ayanatSweat
[0:42:20] premium Syluxrox: God is going to SMITE Hermy for his spitefulness 
[0:42:20] HomelessAnts: idk what i joined but i love it i think 
[0:42:21] testicle_torsion: boonPause
[0:42:22] RDSk: 3rd time this shot was used 
[0:42:27] immunomics: That moment when no butler 
[0:42:30] game-developer thepsynergist2: daxMug
[0:42:30] vip GodliestCat64: Ants in chat 
[0:42:30] Origfx: @GreatSphynx BERMAD no spoilers 
[0:42:34] bits nyeaszel: @HomelessAnts daxMug
[0:42:36] twitch-recap-2023 BallTwistingWizard: It's poisoned 
[0:42:38] vip GodliestCat64: greats8Daxmug
[0:42:49] twitch-recap-2023 Annonn140: hope its poisoned 
[0:42:49] vip Babbott_Orion: When's Gramma got ran over by a reindeer 
[0:42:51] broadcaster turbo GreatSphynx: i hope they laugh 
[0:42:51] subscriber snosa: w! jesusBeBallin
[0:42:51] Origfx: @HomelessAnts name checks out 
[0:42:53] superultracombo-2023 ultvir: jesusBeBallin
[0:42:55] HomelessAnts: homele53Antgasm
[0:42:56] superultracombo-2023 ultrahuhwhat: laced with poison 
[0:42:56] vip Trageenomical: thanks jesus, i guess 
[0:42:56] salad_snack_: cockroaches have eternal souls 
[0:42:58] twitch-recap-2023 Annonn140: gerbPog
[0:43:02] Artacus: NO 
[0:43:03] cabinessence66: wideVIBE
[0:43:03] sub-gift-leader divind95: wideVIBE
[0:43:04] Traedon: NO 
[0:43:05] subscriber JoGoBeans: wideVIBE
[0:43:07] Rooks_Castle: Oh no 
[0:43:07] subscriber sub-gifter explodes5: LOOOOOOOOOOOOOL 
[0:43:07] subscriber twitch-recap-2023 Gnatley: TheVoices
[0:43:08] vera_azure: The special ingredient is love... no, wait... Advion. 
[0:43:09] premium nickynack: wideVIBE
[0:43:09] subscriber snosa: zzooTrip
[0:43:10] vip GodliestCat64: wideVIBE
[0:43:11] Duckiestrides: nO 
[0:43:13] superultracombo-2023 ultvir: no caroling FISHWAR
[0:43:13] twitch-recap-2023 franceybear: zzooTrip
[0:43:14] twitch-recap-2023 BallTwistingWizard: TheVoices
[0:43:17] testicle_torsion: and then he made you mortal and created poverty :)
[0:43:18] subscriber malty_meatia: Happy Birrrthday Je-suuuuus 
[0:43:21] Origfx: zzooTrip
[0:43:22] premium mg42_: TheVoices
[0:43:24] subscriber twitch-recap-2023 n0tthedoctor: greats8Bruh
[0:43:24] Duckiestrides: somebody get the bucket 
[0:43:26] subscriber partner Temiree: wideVIBE
[0:43:27] montrith: The lesson here is that if we only tell capitalists about Jesus they will stop being so greedy 
[0:43:28] Duckiestrides: PLZ 
[0:43:29] machine_head: @vera_azure vendetta nitro these days GLEEBING
[0:43:38] twitch-recap-2023 Fireborn: zzooTrip bug jesus... 
[0:43:41] sub-gift-leader divind95: zzooTrip
[0:43:44] superultracombo-2023 ultrahuhwhat: god love is for everyone, but god's love takes different forms 
[0:43:48] Duckiestrides: bezus 
[0:43:48] Parsley3313: He winked at him... 
[0:43:50] subscriber sofasofia: videochessLowlyWorm
[0:43:51] superultracombo-2023 ultrahuhwhat: choking on fruitcake? god's love 
[0:43:53] RDSk: Da GOAT gift —> jesusBeBallin
[0:43:54] premium cosmonaughtbob: mizarBless 🥮 
[0:44:00] Traedon: @Fireborn zzooTrip Bugsus... 
[0:44:03] glitchcon2020 Lyzerus: ultrawideDoc
[0:44:04] salad_snack_: why do bugs worship human jesus? 
[0:44:06] sub-gift-leader divind95: bugsnax 
[0:44:08] vip TheRealLupos: Jesus is a purple grub 
[0:44:09] Duckiestrides: fake. didnt make bug jesus 
[0:44:14] testicle_torsion: :(
[0:44:14] mick_sq: jesusSpin
[0:44:16] machine_head: @salad_snack_ for creating hoarders 
[0:44:20] subscriber sub-gifter explodes5: capitalism ruining your society? believe it or not, also gods love 
[0:44:22] no_audio KeatsUsername: jesusSpin
[0:44:24] deworming_in_progress: God to people born before Christianity was created -> odoPulp
[0:44:25] Traedon: Why is Jesus still a person? 
[0:44:26] premium cosmonaughtbob: jesusBeBallin
[0:44:30] testicle_torsion: personally I didn’t want God to give us his sons life 
[0:44:38] bits nyeaszel: bluepilled 
[0:44:40] twitch-recap-2023 BallTwistingWizard: That settles it. CEO of Walmart, you are invited to my next Christmas party 
[0:44:41] subscriber premium milesjacob: I am willing to bet this was made by jewish communists 
[0:44:43] subscriber snosa: catPls
[0:44:44] vip TheRealLupos: wideVIBE
[0:44:44] subscriber twitch-recap-2023 n0tthedoctor: greats8JAM
[0:44:45] subscriber JoGoBeans: catPls
[0:44:45] broadcaster turbo GreatSphynx: catJAMGF
[0:44:47] xexsxexs: cremate me please 
[0:44:47] premium nickynack: catJAM
[0:44:47] no_video kirdiee: catPls
[0:44:47] twitch-recap-2023 Annonn140: catJAM
[0:44:49] Origfx: docDis guilt tripped 
[0:44:49] glitchcon2020 Lyzerus: quarkPls
[0:44:50] superultracombo-2023 ultvir: catJammingPolitely
[0:44:50] cabinessence66: catJAMGF
[0:44:50] subscriber twitch-recap-2023 ocarina_boy: CatsJam
[0:44:54] premium steveracecar: even the bugs on my lawn believe in jesus 
[0:44:55] subscriber snosa: WHAT
[0:44:57] premium cosmonaughtbob: vargDuane
[0:44:59] bits nyeaszel: WHAT
[0:45:02] superultracombo-2023 ultrahuhwhat: PartyParrot
[0:45:02] vip TheRealLupos: WHAT
[0:45:06] sub-gift-leader divind95: WHAT
[0:45:12] twitch-recap-2023 BallTwistingWizard: Yeah but Jesus best the fuck out of greedy capitalists 
[0:45:14] premium goldwolf128: :(
[0:45:14] Origfx: BERMAD BANISH THEM 
[0:45:16] twitch-recap-2023 BallTwistingWizard: Beat 
[0:45:18] sub-gift-leader divind95: gawd this is banal 
[0:45:18] subscriber twitch-recap-2023 Gnatley: i hate how the ladybug's faces are shaped 
[0:45:19] subscriber malty_meatia: God's gift should have been just making sin not a thing that send you to Hell 
[0:45:21] twitch-recap-2023 Annonn140: oh fuck off 
[0:45:32] vip TheRealLupos: Sleepo
[0:45:35] xexsxexs: mimir 
[0:45:36] vip GodliestCat64: Sleepo
[0:45:40] bits nyeaszel: Sleepo
[0:45:45] subscriber sub-gifter explodes5: Sleepo
[0:45:45] no_video kirdiee: do not wake him 
[0:45:46] Origfx: dataSleep
[0:45:55] premium Iceckryss: these damn thieves 
[0:45:56] broadcaster turbo GreatSphynx: so they did steal it? 
[0:45:59] Origfx: ONOTrip REFORMED 
[0:46:01] subscriber snosa: lol 
[0:46:01] 22seff22: These guys are wild 
[0:46:08] vip TheRealLupos: sweatFrog
[0:46:12] subscriber twitch-recap-2023 n0tthedoctor: greats8Ono
[0:46:12] machine_head: the grinch dilemma 
[0:46:13] vip artist-badge Guardison: NOOOO
[0:46:13] superultracombo-2023 ultrahuhwhat: sugar high 
[0:46:18] vip GodliestCat64: tendiAAH
[0:46:20] mick_sq: Iggy and Ziggy should have been called Smelly and Stinky 
[0:46:21] Traedon: The fuck is happening? 
[0:46:23] Duckiestrides: is this the grinch gdi 
[0:46:24] Creatures_Features: James and the Giant Fruit Cake? 
[0:46:28] xexsxexs: kidnapped 
[0:46:36] vip GodliestCat64: Huh 
[0:46:36] superultracombo-2023 ultrahuhwhat: roadkill 
[0:46:37] subscriber sub-gifter maxzlock: HUHH 󠀀 
[0:46:39] twitch-recap-2023 Annonn140: HUHH
[0:46:40] vip GodliestCat64: HUHH
[0:46:41] Duckiestrides: HOUH? 
[0:46:42] machine_head: @Duckiestrides that was like a shitty frame for frame reenactment of the grinch falling off the cliff lol 
[0:46:43] Origfx: yoink 
[0:46:46] subscriber sub-gifter explodes5: These caterpillars all look like The Critic 
[0:46:49] superultracombo-2023 Mattmatatt: why do all these caterpillars look like they'd be voiced by Kevin Spacey 
[0:46:51] subscriber malty_meatia: EVERYBODY gets to crash! 
[0:46:52] mick_sq: odoPulp
[0:46:55] Lyvash: All those creatures look disgusting 
[0:46:56] RDSk: is that Marchin Through Georgia HUHH
[0:46:59] Duckiestrides: @Duckiestrides GHHHH 
[0:47:03] superultracombo-2023 Mattmatatt: @explodes5 oh shit yeah that's maybe more accurate than Spacey lol 
[0:47:06] Origfx: OTrip
[0:47:08] bits nyeaszel: 10 
[0:47:14] subscriber sub-gifter explodes5: Critic voiced by Spacey 
[0:47:21] vip GodliestCat64: Let's gift them their stuff back 
[0:47:24] subscriber sub-gifter explodes5: "It stinks." 
[0:47:31] cabinessence66: @RDSk saving christmas from the Confederacy 
[0:47:32] broadcaster turbo GreatSphynx: wideHUH
[0:47:40] Traedon: ??? 
[0:47:41] sub-gift-leader divind95: zzooTrip
[0:47:47] vip afiddler: wideHUH
[0:47:49] twitch-recap-2023 franceybear: zzooTrip 󠀀 
[0:47:51] subscriber malty_meatia: No 
[0:47:52] twitch-recap-2023 Annonn140: all it takes to fix capitalism is to tell the rich about jesus FeelsStrongMan
[0:47:52] Bladestorm01: YOU ALMOSTMLMMAKE THEM STARVE ASSHOLE 
[0:47:56] grumzirg: greats8ZooTrip
[0:47:57] Duckiestrides: thank you bug capitalists 
[0:47:57] itsjuicefruit: god bless 
[0:47:58] SushiGummy: BERMAD NO 
[0:47:59] no_video kirdiee: monkaS
[0:47:59] subscriber snosa: huh 
[0:48:00] sub-gift-leader divind95: wideHUH
[0:48:01] vip GodliestCat64: ayanatSweat
[0:48:01] xexsxexs: froggyFace
[0:48:02] cabinessence66: FROG 
[0:48:02] machine_head: lmao 
[0:48:03] subscriber snosa: aww 
[0:48:03] vip GodliestCat64: Oh 
[0:48:04] bits nyeaszel: froggyFace
[0:48:04] twitch-recap-2023 wallacewellactually: ok 
[0:48:06] subscriber twitch-recap-2023 n0tthedoctor: greats8Froggy
[0:48:06] vip TheRealLupos: froggyFace
[0:48:08] Duckiestrides: oh my gawd :0 
[0:48:08] Traedon: IS THAT GOD? 
[0:48:08] vip bits Jane_Inferno: Clap
[0:48:09] vip GodliestCat64: I thought the frog was about to eat them 
[0:48:09] subscriber bits unspelld: greats8Froggy
[0:48:10] vip GodliestCat64: TREKW
[0:48:11] subscriber partner Temiree: greats8Froggy
[0:48:11] superultracombo-2023 Mattmatatt: thought the frog was gonna eat them all 
[0:48:11] subscriber kakabookake: froggyFace
[0:48:14] subscriber AgentAtaraxia: greats8Froggy
[0:48:19] vip TheRealLupos: wideHUH
[0:48:19] machine_head: froggyFace
[0:48:19] sub-gift-leader divind95: froggyFace
[0:48:23] subscriber snosa: froggyFace
[0:48:24] Parsley3313: a dentist? why? 
[0:48:27] bits nyeaszel: odoLUL DENTAL CARIES odoLUL
[0:48:29] subscriber AgentAtaraxia: FIRE
[0:48:29] twitch-recap-2023 wallacewellactually: reference to rudolph 
[0:48:31] machine_head: death 
[0:48:31] xexsxexs: electrocution 
[0:48:32] vip GodliestCat64: Explosion
[0:48:33] subscriber snosa: Explosion
[0:48:33] RDSk: @cabinessence66 Robert "Grinch" Lee 
[0:48:35] LeginNoslen: Jay Sherman caterpillars 
[0:48:40] Lyvash: Explosion
[0:48:41] subscriber overwatch-league-insider_1 Howoriginal: I love Barnacle Boy 
[0:48:43] bits nyeaszel: zzooTrip
[0:48:59] subscriber kakabookake: zzooTrip fruitcake 
[0:49:01] subscriber premium Kythuulu: holy shit its rick and bubba 
[0:49:02] no_video kirdiee: wretched creatures 
[0:49:07] vip TheRealLupos: Oh yeah, that one elf who wanted to be a dentist 
[0:49:07] xexsxexs: jibus 
[0:49:12] Traedon: the gooblers 
[0:49:19] Duckiestrides: tiniest snowglobe smallert han a pea 
[0:49:21] vip GodliestCat64: WHY aren't you at ELF PRACTICE odoCrunge
[0:49:22] broadcaster turbo GreatSphynx: wideHUH
[0:49:25] machine_head: thanks god 
[0:49:25] Creatures_Features: monkaS
[0:49:25] subscriber snosa: zzooTrip
[0:49:25] twitch-recap-2023 Annonn140: WHAT
[0:49:29] superultracombo-2023 Mattmatatt: god confirmed 
[0:49:29] subscriber premium milesjacob: no god reveal? 
[0:49:30] SushiGummy: HUHH
[0:49:30] xexsxexs: god bless america 
[0:49:31] itsjuicefruit: ty 
[0:49:36] no_video kirdiee: Clap
[0:49:36] subscriber sub-gifter maxzlock: god only speaks to bugs 
[0:49:37] vip GodliestCat64: Clap
[0:49:38] Bladestorm01: they have a permanent connection to god 
[0:49:39] subscriber sub-gifter explodes5: god bless god 
[0:49:40] subscriber snosa: Clap
[0:49:41] broadcaster turbo GreatSphynx: that sucked 
[0:49:47] RDSk: FROG WAS GOD OYOTrip
[0:49:47] itsjuicefruit: lmfao 
[0:49:48] subscriber premium milesjacob: don knotts! 
[0:49:49] Creatures_Features: yeh lol 
[0:49:49] subscriber kakabookake: delete this NOW 
[0:49:50] superultracombo-2023 ultrahuhwhat: caked 
[0:49:51] vip TheRealLupos: the real fruitcake was the cockroach couple with their adopted flea son 
[0:49:51] sub-gift-leader divind95: yeah that wasn't even fun to make fun of 
[0:49:52] Lyvash: Foul creatures 
[0:49:52] Duckiestrides: a fruuuck chrostmas 
[0:49:53] superultracombo-2023 Mattmatatt: is god gonna be in the credits? that would be pretty blasphemous no? 
[0:49:53] subscriber malty_meatia: Clap horrid 
[0:49:54] subscriber sub-gifter explodes5: who voiced god 
[0:49:56] subscriber sub-gifter explodes5: ? 
[0:49:56] deworming_in_progress: god was just watching the bugs starve all this time and didn't do anything gordonDisgust
[0:49:56] machine_head: that wasn't the grinch, that was the gunt 
[0:50:01] superultracombo-2023 ultrahuhwhat: wake and cake 
[0:50:02] twitch-recap-2023 Annonn140: Clap
[0:50:03] subscriber premium Kythuulu: the capitalist cockroaches were voiced by two popular radio hosts where I live 
[0:50:03] Traedon: I've seen far worse this past week. 
[0:50:05] premium nickynack: catPls
[0:50:06] subscriber JoGoBeans: catPls
[0:50:07] no_video kirdiee: catPls Clap
[0:50:07] subscriber partner Temiree: hyenaDance
[0:50:08] subscriber twitch-recap-2023 Gnatley: that was really god 
[0:50:08] broadcaster turbo GreatSphynx: Gubbled Gubbled Gubbled
[0:50:08] SushiGummy: catJAM
[0:50:09] subscriber snosa: catPls
[0:50:12] subscriber sub-gifter explodes5: Who voiced god, I missed it, and was god first in the credits? 
[0:50:13] twitch-recap-2023 Annonn140: catPls
[0:50:13] Spie812: catPls
[0:50:13] vip GodliestCat64: catPls
[0:50:14] Lyvash: catPls
[0:50:15] subscriber malty_meatia: catPls horrid 
[0:50:15] sub-gift-leader divind95: catPls
[0:50:17] glhf-pledge Vulkarl: catPls
[0:50:17] subscriber sofasofia: catPls
[0:50:17] twitch-recap-2023 Fireborn: TheVoices
[0:50:20] subscriber kakabookake: NotLikeThis catPls NotLikeThis
[0:50:23] SushiGummy: catPls
[0:50:23] superultracombo-2023 Mattmatatt: I only saw the last few minutes of that and that shit sucked a big egg 
[0:50:24] subscriber twitch-recap-2023 ocarina_boy: catPls Clap
[0:50:24] twitch-recap-2023 zipp_leafeon: catPls
[0:50:24] superultracombo-2023 ultrahuhwhat: catJAM
[0:50:28] premium sigmacatboy: catPls
[0:50:29] bits nyeaszel: catPls
[0:50:32] machine_head: TheVoices OUUUUUUU 
[0:50:36] Duckiestrides: chatPls chatPls chatPls
[0:50:37] glhf-pledge Vulkarl: TheVoices catPls TheVoices
[0:50:37] Parsley3313: @Mattmatatt D:
[0:50:37] deworming_in_progress: catPls
[0:50:38] subscriber sub-gifter explodes5: holy smokes that was special 
[0:50:38] subscriber robotsnake: catPls
[0:50:39] subscriber twitch-recap-2023 Gnatley: TheVoices
[0:50:39] SushiGummy: catPls TrumpetTime
[0:50:42] subscriber premium Kythuulu: I feel like im going insane 
[0:50:45] premium steveracecar: bonesAH
[0:50:46] superultracombo-2023 Mattmatatt: this music is so crazy dissonant haha 
[0:50:46] premium cosmonaughtbob: catPls
[0:50:48] mick_sq: hapiCat hapiCat hitMe
[0:50:50] Bladestorm01: They almost let them starve 
[0:50:56] twitch-recap-2023 ArkorenSnep: catPls
[0:51:00] subscriber malty_meatia: Demented psycho carols 
[0:51:01] bits nyeaszel: @Kythuulu happy gongmas 
[0:51:02] xexsxexs: hapiCat ffzW
[0:51:04] machine_head: the alien one from last night farms this one 
[0:51:10] subscriber JoGoBeans: damn those drums catPls DrumTime
[0:51:13] MrBoo809: @kythuulu roll tide 
[0:51:37] subscriber premium Kythuulu: @MrBoo809 welcome to hell 
[0:51:44] twitch-recap-2023 Professor_Pineapple_: catPls
[0:51:49] MrBoo809: Hahaha 
[0:51:51] superultracombo-2023 Mattmatatt: whatcha know good 
[0:51:57] Duckiestrides: PianoTime PianoTime PianoTime
[0:52:01] vip GodliestCat64: catPls
[0:52:04] subscriber AgentAtaraxia: catJAM
[0:52:04] sub-gift-leader divind95: Yeat
[0:52:06] Lyvash: catPls
[0:52:07] machine_head: TheVoices
[0:52:08] SushiGummy: catPls
[0:52:09] subscriber partner Temiree: catPls
[0:52:09] subscriber snosa: funnywhitecat5
[0:52:10] no_video kirdiee: clownDoc
[0:52:15] bits nyeaszel: gary odoNo
[0:52:16] vip GodliestCat64: I wonder if christmas is coming 
[0:52:17] xexsxexs: Why isn't my name in the credits 
[0:52:18] subscriber AgentAtaraxia: Weslet
[0:52:19] premium steveracecar: catPls
[0:52:20] subscriber premium Kythuulu: catPls
[0:52:22] subscriber KatalepsyKills: catPls
[0:52:26] Salty_peanut: catPls
[0:52:37] subscriber sub-gifter explodes5: ALLAMARAINE
[0:52:37] superultracombo-2023 Mattmatatt: Christmas just happened so we gotta listen to this song for the next 364 days 
[0:52:38] Traedon: @xexsxexs Yeah! We watched it, we should get credit! 
[0:52:43] twitch-recap-2023 BallTwistingWizard: They made this in 2005??? 
[0:52:54] broadcaster turbo GreatSphynx: !break 
[0:52:54] moderator partner Nightbot: It's time for a break, don't go away. 3min of ads will play so you don't have to see any ads for the next hour. Otherwise chill and enjoy the music. 
[0:52:57] subscriber sub-gifter explodes5: Jeeeeeez 
[0:52:58] broadcaster turbo GreatSphynx: gotta do a break 
[0:52:58] subscriber snosa: catSittingPolitely
[0:53:02] premium giant_robots: happy crumbus 
[0:53:08] superultracombo-2023 Mattmatatt: @DarthJawa5 they made this in a CAVE with a box of SCRAPS 
[0:53:11] subscriber sub-gifter maxzlock: the cg quality wasnt terrible, especially for christian animation 
[0:53:12] machine_head: catSittingPolitely honseWalk
[0:53:12] Bladestorm01: merry crisis 
[0:53:16] Traedon: I'm heading to bed. Have a good crimbino fello gongoers 
[0:53:19] twitch-recap-2023 franceybear: catJammingPolitely
[0:53:20] subscriber JoGoBeans: wideVIBE
[0:53:21] sub-gift-leader divind95: GuitarTime
[0:53:22] xexsxexs: catSittingPolitely FIRE
[0:53:24] subscriber twitch-recap-2023 Piyokopyo: catJAMM GuitarTime
[0:53:28] subscriber AgentAtaraxia: Pepechill
[0:53:28] Spie812: campfireCats
[0:53:31] subscriber robotsnake: CatGuitar
[0:53:34] machine_head: Sadge 
[0:53:34] subscriber twitch-recap-2023 Piyokopyo: coolHat
[0:53:35] Duckiestrides: gongo
[0:53:36] bits nyeaszel: odoNo GuitarTime
[0:53:37] subscriber sub-gifter maxzlock: RHCP jumpscare 
[0:53:38] Creatures_Features: Sadge 
[0:53:38] Bladestorm01: @traedon Sleepo
[0:53:39] subscriber snosa: Yeat GuitarTime
[0:53:39] subscriber JoGoBeans: jmikeSadbungle
[0:53:40] premium nickynack: more rhcp OYOTrip
[0:53:41] vip afiddler: FeelsBadMan
[0:53:49] SushiGummy: Pepechill
[0:54:04] Duckiestrides: gongo gongo gongo gongo gongo gongo gongo gongo gongo
[0:54:08] vip twitch-recap-2023 viahate: wideVIBE
[0:54:09] vip whette_fahrtz: ALLAMARAINE
[0:54:14] superultracombo-2023 Mattmatatt: is this new or old RHCP? 
[0:54:18] subscriber AgentAtaraxia: Old 
[0:54:19] vip GodliestCat64: wideVIBE
[0:54:23] turbo nivis_shadoth: !cornography 
[0:54:23] moderator partner Nightbot: Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn
[0:54:24] xexsxexs: mald rhcp 
[0:54:28] premium nickynack: from one hot minute iirc 
[0:54:29] Duckiestrides: COOOORN 
[0:54:29] subscriber twitch-recap-2023 Piyokopyo: CORN
[0:54:30] grandfatigue: CORN
[0:54:37] xexsxexs: !nukie 
[0:54:37] subscriber malty_meatia: Corn
[0:54:38] Duckiestrides: CORN CORN CORN CORN CORN
[0:54:38] subscriber kakabookake: Funnywhitecat5
[0:54:42] xexsxexs: NUKIE 
[0:54:43] MrBoo809: @kythuulu I was forced to listen to WZZK growing up so heard a good bit of Rick and Bubba 
[0:54:52] subscriber sub-gifter maxzlock: I need to listen to Stadium Arcadium again sometime 
[0:54:53] subscriber snosa: CORN
[0:55:01] premium mg42_: catJAMGF
[0:55:02] Duckiestrides: gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo gongo
[0:55:05] broadcaster turbo GreatSphynx: i am not a fan of stadium arcadium 
[0:55:12] subscriber sub-gifter maxzlock: awww man, really? 
[0:55:16] superultracombo-2023 Mattmatatt: this is p good, not a big fan of RHCP but Kiedis' voice isn't super grating in this one 
[0:55:17] subscriber sub-gifter maxzlock: Slow cheetah? 
[0:55:17] subscriber snosa: CatGuitar
[0:55:21] broadcaster turbo GreatSphynx: yeah i think thats when they went down hill 
[0:55:24] subscriber premium Kythuulu: @MrBoo809 yeah my parents have listened to them (and still do) since I was in middle school 
[0:55:25] broadcaster turbo GreatSphynx: theres like a couple ok songs 
[0:55:26] premium nickynack: CatGuitar
[0:55:53] lintsock: gogon 
[0:56:03] superultracombo-2023 Mattmatatt: I can't get over that super new RHCP song where Kiedis has that bizarre accent 
[0:56:04] subscriber sub-gifter maxzlock: yeah its a bit bloated 
[0:56:05] subscriber twitch-recap-2023 Piyokopyo: jarJAM DrumTime
[0:56:10] vip Snudl: CatGuitar Wawa popCat Wawa RobertJam
[0:56:11] hillbillyinablimp: wideVIBE
[0:56:16] subscriber JoGoBeans: I heard a LIDL girl wideVIBE
[0:56:18] subscriber sub-gifter maxzlock: @Mattmatatt Black Summer? 
[0:56:27] superultracombo-2023 Mattmatatt: @maxzlock yeah that one 
[0:56:32] superultracombo-2023 Mattmatatt: he's doing like a sea shanty voice or some shit 
[0:56:37] subscriber sub-gifter maxzlock: Yeah lmao 
[0:56:51] broadcaster turbo GreatSphynx: idk if they released anything more recently but their last album i wasnt big on either 
[0:56:58] broadcaster turbo GreatSphynx: basically californication and earlier i like 
[0:57:03] broadcaster turbo GreatSphynx: by the way has some ok songs too 
[0:57:25] superultracombo-2023 Mattmatatt: the most joy I get from them is saying two random words like Card Shark 
[0:57:31] superultracombo-2023 Mattmatatt: my gf and I do that all the time 
[0:57:32] Lyvash: ok is generic to me 
[0:57:33] subscriber JoGoBeans: Jebaited
[0:57:35] superultracombo-2023 Mattmatatt: and then make bass mouth noises 
[0:57:37] broadcaster turbo GreatSphynx: opsmo is fucking shit up hold on 
[0:57:37] MrBoo809: @kythuulu I'm glad I don't have to anymore lol. I didn't even know they were still on the air 
[0:57:38] broadcaster turbo GreatSphynx: !break 
[0:57:38] moderator partner Nightbot: It's time for a break, don't go away. 3min of ads will play so you don't have to see any ads for the next hour. Otherwise chill and enjoy the music. 
[0:57:43] subscriber snosa: !osmo 
[0:57:43] moderator partner Nightbot: osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick
[0:57:47] premium nickynack: osmoStare
[0:57:49] subscriber JoGoBeans: damn no bet 
[0:57:50] subscriber twitch-recap-2023 Piyokopyo: osmoStare DESTROY 
[0:57:50] vip TheRealLupos: osmoBlep
[0:57:52] turbo nivis_shadoth: osmoStare
[0:57:52] vip GodliestCat64: osmoPat
[0:57:53] subscriber snosa: lol 
[0:57:56] subscriber partner Temiree: osmoStare
[0:57:56] subscriber twitch-recap-2023 n0tthedoctor: LUL
[0:57:57] subscriber sub-gifter maxzlock: AHH 
[0:57:58] subscriber JoGoBeans: pgeKEK
[0:57:58] grandfatigue: osmoD
[0:57:59] turbo nivis_shadoth: osmoLick
[0:58:00] salad_snack_: ASS 
[0:58:00] subscriber sub-gifter maxzlock: osmoBlep
[0:58:03] twitch-recap-2023 franceybear: osmoStare
[0:58:05] turbo nivis_shadoth: tendiAAH
[0:58:08] RDSk: ASS 
[0:58:10] grandfatigue: red hot ass 
[0:58:11] twitch-recap-2023 Lewd_Tuna: gongo
[0:58:14] Canidaen: Danny boyyyy 
[0:58:15] MrBoo809: greats8Osmopat
[0:58:17] turbo ARose845: no way I love this song 
[0:58:20] subscriber snosa: catJammingPolitely
[0:58:28] vip TheRealLupos: spynxBuh argoKill osmoD
[0:58:36] sub-gift-leader divind95: catJammingPolitely
[0:58:38] grandfatigue: RobertJam
[0:58:51] 22seff22: Is this they might be giants 
[0:58:58] bits nyeaszel: i got a weird mastercard NFT ad 
[0:58:59] JPeaches: it's dan deacon 
[0:59:02] subscriber twitch-recap-2023 Gnatley: limesDance limesDance
[0:59:08] vip Snudl: catJAM catJamrgb h! catJAM
[0:59:08] subscriber kakabookake: catJAMGF
[0:59:09] superultracombo-2023 Mattmatatt: man Dan Deacon what a throwback 
[0:59:16] superultracombo-2023 Mattmatatt: my sibling loved him growing up 
[0:59:33] subscriber snosa: VIBE
[0:59:35] vip GodliestCat64: Funnywhitecat5
[0:59:40] sub-gift-leader divind95: heyaheyaheyaheyaheya catPls
[1:00:04] turbo nivis_shadoth: heyaya heyaya 
[1:00:05] superultracombo-2023 Mattmatatt: Dan da OG funny pitched voice effects indie dude 
[1:00:07] hillbillyinablimp: catPls catPls catPls catPls catPls catPls
[1:00:16] subscriber premium Kythuulu: @MrBoo809 so true, I rarely hear about them after moving out lmao 
[1:00:29] bits nyeaszel: zzooTrip
[1:00:31] subscriber KatalepsyKills: so animal collective 
[1:00:35] subscriber premium Kythuulu: catPls
[1:01:16] subscriber malty_meatia: I haven't heard this song since Adult Swim, dang. Almost missed it 
[1:01:25] broadcaster turbo GreatSphynx: catPls catPls
[1:01:40] bits nyeaszel: funnywhitecat5 Funnywhitecat5 funnywhitecat5
[1:01:42] subscriber malty_meatia: NESSIE
[1:01:42] subscriber sofasofia: catPls
[1:01:49] subscriber premium Kythuulu: catPls catPls catPls
[1:02:03] Hot_Samson: song? 
[1:02:06] subscriber snosa: catPls
[1:02:06] glitchcon2020 Lyzerus: pogonaRave
[1:02:15] turbo nivis_shadoth: jarJAM greats8JAM
[1:02:19] sub-gift-leader divind95: When I was done dying by Dan Deacon 
[1:02:20] sub-gift-leader divind95: OYTrip
[1:02:23] vip GodliestCat64: OYTrip
[1:02:24] subscriber snosa: OYTrip
[1:02:27] bits nyeaszel: OYTrip
[1:02:27] turbo nivis_shadoth: OYTrip
[1:02:28] subscriber twitch-recap-2023 Gnatley: OYTrip
[1:02:28] twitch-recap-2023 franceybear: OYTrip
[1:02:31] subscriber malty_meatia: OYTrip
[1:02:34] vip Snudl: OYTrip
[1:02:35] sub-gift-leader divind95: YO 
[1:02:35] subscriber malty_meatia: Lol 
[1:02:36] vip twitch-recap-2023 viahate: NOOOO
[1:02:37] twitch-recap-2023 Professor_Pineapple_: OYOTrip
[1:02:37] MrBoo809: davekaWAT
[1:02:37] subscriber JoGoBeans: oh shit 
[1:02:38] vip GodliestCat64: YES 
[1:02:38] vip Babbott_Orion: IUTS TIME 
[1:02:38] subscriber sofasofia: omfg 
[1:02:39] subscriber snosa: oh man 
[1:02:39] bits nyeaszel: OYOTrip
[1:02:39] cabinessence66: NOOOO
[1:02:41] premium DinnerCalzone: YOOOO 
[1:02:41] turbo nivis_shadoth: OYOTrip
[1:02:41] vip Snudl: NOOOO
[1:02:43] subscriber sub-gifter maxzlock: oh no 
[1:02:43] subscriber robotsnake: OYOTrip OH SHIT 
[1:02:44] subscriber sofasofia: AAAAAA 
[1:02:45] sub-gift-leader divind95: nostalgia here we come 
[1:02:45] subscriber JoGoBeans: SANTA'S GONNA SUE THE FUCK OUT OF SANTA 
[1:02:47] subscriber premium Kythuulu: lets fucking go 
[1:02:49] vip uforgot: atamYada
[1:02:49] subscriber JoGoBeans: wait 
[1:02:49] superultracombo-2023 Mattmatatt: oh god I think I remember this 
[1:02:51] subscriber AgentAtaraxia: GRANDMA, WATCH OUT 
[1:02:51] subscriber malty_meatia: "WE'RE BEGGING YOU" 
[1:02:51] subscriber snosa: catPls
[1:02:51] subscriber JoGoBeans: I said that wrong 
[1:02:53] subscriber sofasofia: CLASSIC LFG 
[1:02:55] twitch-recap-2023 franceybear: OMGGGG!!! 
[1:02:55] sub-gift-leader divind95: GRANDMA'S GONNA SUE THE SHIT OUT OF SANTA 
[1:02:58] subscriber AgentAtaraxia: OH SHIT OH FUCK 
[1:03:00] Boscodbear: is this that movie that was on cartoon network all the time 
[1:03:02] bits nyeaszel: ST tendiAAH AHL 
[1:03:02] vera_azure: Oh shit. Radock used to YTP this here and there. 
[1:03:05] vip Babbott_Orion: @Boscodbear yes 
[1:03:05] RDSk: wHY Sphynx, WHYYYY NOOOO
[1:03:06] subscriber JoGoBeans: @divind95 that's the one 
[1:03:13] vip artist-badge Guardison: based 
[1:03:14] Boscodbear: @Babbott_Orion oh no 
[1:03:17] SushiGummy: catPls
[1:03:18] subscriber partner Temiree: OH SHIT temirePog
[1:03:18] subscriber snosa: lol 
[1:03:19] turbo nivis_shadoth: oh God it is that one. 
[1:03:20] vip twitch-recap-2023 viahate: once was enough to last me a lifetime sumsaltSad
[1:03:20] vip Trageenomical: oh god oh FUCK 
[1:03:23] premium goldwolf128: OH GOD THIS MOVIE 
[1:03:23] subscriber solberserker: OH GOD 
[1:03:23] vip artist-badge Guardison: catPls
[1:03:24] Creatures_Features: omg
[1:03:25] aimlessdemon: OH MY GOD 
[1:03:25] subscriber overwatch-league-insider_1 Howoriginal: jmikeSoypog HahaReindeer
[1:03:27] subscriber JoGoBeans: catPls
[1:03:28] bits nyeaszel: catPls
[1:03:28] Dust1210: saw this on rerun so many times 
[1:03:28] subscriber twitch-recap-2023 ocarina_boy: catPls
[1:03:29] glitchcon2020 Lyzerus: YESSS 
[1:03:29] sub-gift-leader divind95: catPls
[1:03:30] riotdyke: CLASSIC 
[1:03:30] no_video kirdiee: monkaS
[1:03:30] Bladestorm01: IT IS greats8YoTrip
[1:03:31] SushiGummy: why is THAT your favorite?? 
[1:03:31] subscriber premium Kythuulu: I havent seen this in ages oh my God 
[1:03:32] subscriber snosa: catPls
[1:03:33] turbo RedKazoo: YEWS 
[1:03:34] vip artist-badge Raxxmus: oh my god 
[1:03:34] vip Snudl: TheVoices
[1:03:35] vip Trageenomical: Stare <-- this movie as an emote 
[1:03:36] subscriber sofasofia: yesss catPls catPls
[1:03:36] subscriber partner Temiree: dogkingBuiJAM
[1:03:37] vip twitch-recap-2023 blaseGraham: greats8YoTrip
[1:03:38] vip artist-badge Guardison: DEAD 
[1:03:38] subscriber snosa: :0 
[1:03:39] RDSk: GILF 
[1:03:40] cherrrybomb567: PogChamp
[1:03:40] vip afiddler: monkaS
[1:03:40] aimlessdemon: RIP 
[1:03:40] subscriber twitch-recap-2023 Piyokopyo: oh noooo 
[1:03:41] subscriber JoGoBeans: I used to watch this movie a shitload of times as a kid because I had nothing else for entertainment 
[1:03:41] twitch-recap-2023 WolfzenSkiigh: Dead 
[1:03:42] glitchcon2020 Lyzerus: Dead 
[1:03:42] subscriber twitch-recap-2023 Piyokopyo: this movie 
[1:03:42] superultracombo-2023 Mattmatatt: yeah I had to have seen this so many times but don't remember any of it 
[1:03:42] bits nyeaszel: DED 
[1:03:43] broadcaster turbo GreatSphynx: deadass
[1:03:44] subscriber snosa: DIESOFCRINGE
[1:03:44] subscriber bits unspelld: i saw this movie multiple times growing up 
[1:03:45] Lastrin: Oh god this LUL
[1:03:45] Boscodbear: SPLATTER SPREE 
[1:03:46] SushiGummy: NOOOO
[1:03:47] subscriber premium KamiGousama: oh god no lol 
[1:03:47] turbo nivis_shadoth: deadass
[1:03:48] sparquah: dead 
[1:03:49] Bladestorm01: FUCKING DEAD 
[1:03:49] twitch-recap-2023 Professor_Pineapple_: GRADMA LOOK OUT 
[1:03:50] premium goldwolf128: drink ok 
[1:03:51] subscriber hunnietoots: NOO WAY zzooTrip
[1:03:51] subscriber snosa: lol 
[1:03:54] premium goldwolf128: thanlk god 
[1:03:55] subscriber solberserker: IT ALMOST PUT AN END TO HER LIFE 
[1:03:56] sub-gift-leader divind95: she's dead D:
[1:03:56] 22seff22: And an end to her life 
[1:03:57] premium giant_robots: grandma has died 
[1:03:57] subscriber AgentAtaraxia: Grandma dead 
[1:03:58] Lastrin: Yeah I saw this a few times too, Cartoon Network usedto play it 
[1:03:58] vip TheRealLupos: Santa doing a hit'n'run 
[1:03:58] subscriber twitch-recap-2023 ocarina_boy: deadass
[1:03:59] subscriber snosa: dataSleep
[1:03:59] DumboAKAwumbo: i spent 25 years trying to forget this tune after seeing it on TV odoNo
[1:04:00] premium X_eroz: Grandma was kinda racist so dont feel bad, she had it coming 
[1:04:02] vip Trageenomical: :) Cityville 
[1:04:04] subscriber snosa: v! dataSleep
[1:04:08] Spie812: RIP BOZO 
[1:04:10] vaesari: fricken classic 
[1:04:12] SushiGummy: "almost put an end to christmas" hard cut to dead grandma 
[1:04:12] glitchcon2020 Lyzerus: Grampa's gunna sue the pants off of Santa. catPls
[1:04:13] vip twitch-recap-2023 viahate: imagine she just straight up died and we didn't have to go through all of this story? 
[1:04:13] superultracombo-2023 Mattmatatt: lol 
[1:04:13] vip Babbott_Orion: Spankenheimer 
[1:04:16] bits nyeaszel: Up moment 
[1:04:16] vip GodliestCat64: Cartoon network still airs it I think 
[1:04:16] vaesari: spankenheimer 
[1:04:17] subscriber sofasofia: spankenheimer.. 
[1:04:18] subscriber twitch-recap-2023 Piyokopyo: made up name 
[1:04:19] subscriber premium Kythuulu: spankenheimer 
[1:04:19] subscriber solberserker: SPAKENHEIMER... 
[1:04:21] vip uforgot: atamLewd
[1:04:23] subscriber solberserker: My le gift... 
[1:04:26] MrBoo809: Run over by 14 reindeer? 
[1:04:27] superultracombo-2023 Mattmatatt: is this like a Spencer's Gifts? 
[1:04:35] Bladestorm01: ROBERT SPANKENHEIMER 
[1:04:37] macil_tech: she was competition for Santa. Santa had to take her out 
[1:04:41] broadcaster turbo GreatSphynx: jank spanken 
[1:04:43] Boscodbear: her eyes were a little off for a moment 
[1:04:43] SushiGummy: I am become slap, spanker of booty 
[1:04:44] salad_snack_: gilf counter: 2 
[1:04:46] subscriber twitch-recap-2023 Piyokopyo: @Mattmatatt the cringe porn shirts and novelties are in the back 
[1:04:47] vip artist-badge Guardison: BERMUS
[1:04:48] sub-gift-leader divind95: is that daphne 
[1:04:49] glitchcon2020 Lyzerus: BERMUS
[1:04:49] vip Snudl: HUHH
[1:04:51] bits nyeaszel: BERMUS
[1:04:53] aimlessdemon: milf counter: 1 
[1:04:53] vip artist-badge Guardison: odoAWOOGA
[1:04:55] mick_sq: Oh god it's this. 
[1:05:03] Rooks_Castle: @aimlessdemon I think you mean 2 BERMUS
[1:05:04] subscriber snosa: it's this 
[1:05:09] subscriber twitch-recap-2023 Piyokopyo: y-you too 
[1:05:12] sub-gift-leader divind95: she is everyone's grandma 
[1:05:12] twitch-recap-2023 Annonn140: y-you too 
[1:05:13] vip premium lmaoboat: odoAWOOGA
[1:05:16] vip premium plorf: odoAWOOGA
[1:05:19] subscriber snosa: odoAWOOGA
[1:05:19] SushiGummy: grandma you're SINKING this business 
[1:05:22] subscriber JoGoBeans: D:
[1:05:22] twitch-recap-2023 Annonn140: BERMUS
[1:05:22] superultracombo-2023 Mattmatatt: this animation does no match this performance haha 
[1:05:23] aimlessdemon: @aimlessdemon I think you're right LUL
[1:05:24] superultracombo-2023 ultvir: daphne odoAWOOGA
[1:05:24] Solbiaa: D:
[1:05:26] subscriber premium Kythuulu: would 
[1:05:28] vip twitch-recap-2023 blaseGraham: greats8Bermus
[1:05:28] superultracombo-2023 ultrahuhwhat: the entire economy runs on credit yo 
[1:05:31] Creatures_Features: I can't tell who the viallian is yet 
[1:05:35] subscriber AgentAtaraxia: GRANDMA, IF WE DON'T START SELLING, WE'RE GONNA LOSE THE STORE 
[1:05:37] vip artist-badge Guardison: Link 
[1:05:41] Boscodbear: "thats why i sued santa" 
[1:05:42] subscriber sofasofia: nice economy 
[1:05:44] sub-gift-leader divind95: GRANDMA THE SHAREHOLDERS 
[1:05:50] testicle_torsion: God I wish she would lecture me on profit margins 
[1:05:51] Duckiestrides: LINK 
[1:05:52] vip GodliestCat64: There's one ytp that always comes to mind now thinking about this 
[1:05:54] SushiGummy: are they setting up a murder motive? 
[1:05:56] subscriber superultracombo-2023 D_tector008: @TheTragicomical daphe is wilding 
[1:05:56] subscriber AgentAtaraxia: THEY'RE GONNA TAKE MY THUMBS, GRANDMA 
[1:05:59] broadcaster turbo GreatSphynx: nerd 
[1:06:03] Boscodbear: get out of his room HES PLAYING MINECRAFT 
[1:06:05] subscriber twitch-recap-2023 Piyokopyo: jmikeAktly NEEEEEERD 
[1:06:07] subscriber twitch-recap-2023 ocarina_boy: lol 
[1:06:07] Lastrin: D:
[1:06:09] testicle_torsion: reality challenged 
[1:06:09] premium giant_robots: 🤓 my rollerblades 
[1:06:10] subscriber robotsnake: Based
[1:06:11] vip Trageenomical: @D_tector008 daphne always doing this shit 
[1:06:12] subscriber AgentAtaraxia: Locked stuff him 
[1:06:18] testicle_torsion: we are all reality challenged 
[1:06:23] subscriber malty_meatia: Haha bork bork Xd 
[1:06:23] broadcaster turbo GreatSphynx: lmao 
[1:06:24] DumboAKAwumbo: only nerds use computers 🤓 
[1:06:28] subscriber snosa: D:
[1:06:29] subscriber premium Kythuulu: D:
[1:06:31] aimlessdemon: D:
[1:06:33] vip artist-badge Guardison: NOOOO
[1:06:34] sub-gift-leader divind95: Reality challeneged needs to come back as an insult 
[1:06:35] glitchcon2020 Lyzerus: D:
[1:06:36] subscriber sofasofia: D:
[1:06:36] bits nyeaszel: D:
[1:06:37] twitch-recap-2023 Annonn140: D:
[1:06:38] mick_sq: HolidaySanta <-I'm real I swear 
[1:06:39] subscriber partner Temiree: D:
[1:06:39] subscriber malty_meatia: D:
[1:06:39] subscriber twitch-recap-2023 carlysle_: D: WHAT DO YOU MEAN 
[1:06:41] subscriber premium Kythuulu: he looks fucking traumatized 
[1:06:41] subscriber AgentAtaraxia: D:
[1:06:42] vip twitch-recap-2023 blaseGraham: FeelsSnowMan
[1:06:42] bits nyeaszel: the trifecta 
[1:06:46] sub-gift-leader divind95: Norm 
[1:06:51] subscriber AgentAtaraxia: Dads already wasted 
[1:06:52] Duckiestrides: D:
[1:06:52] bits nyeaszel: NROM? 
[1:06:52] subscriber solberserker: is that Fred's VA? 
[1:06:54] bits nyeaszel: NORM? 
[1:07:01] subscriber malty_meatia: Thanta Clauth realll 
[1:07:05] machine_head: cityvill ownall 
[1:07:05] Duckiestrides: norp 
[1:07:14] no_video kirdiee: I hate it 
[1:07:14] subscriber snosa: it's not kewl 
[1:07:16] Creatures_Features: i mean she has a point 
[1:07:18] twitch-recap-2023 Annonn140: not wrong 
[1:07:18] subscriber AgentAtaraxia: PUMP HARDER 
[1:07:19] broadcaster turbo GreatSphynx: everquest dog noise 
[1:07:24] vip artist-badge Guardison: papaPlz
[1:07:25] superultracombo-2023 ultrahuhwhat: inflatable pl.. tree 
[1:07:26] mick_sq: Yeah, plastics are so much better 
[1:07:27] P0LYB1U5: I unfortunately watched this on cable. 
[1:07:27] subscriber uchuu_elodie: my cats would murder an inflatable tree in 3 seconds 
[1:07:28] vip GodliestCat64: GORM
[1:07:29] bits nyeaszel: christmas tree inflation 
[1:07:29] hillbillyinablimp: this is that inflatable buttplug they put up in paris isnt it 
[1:07:29] subscriber premium KamiGousama: cats LOVE it 
[1:07:32] glitchcon2020 Lyzerus: BACK IN MY DAY 
[1:07:34] twitch-recap-2023 Annonn140: aww shit 
[1:07:35] subscriber AgentAtaraxia: Grandpas lost it 
[1:07:36] vip Babbott_Orion: like minecraft 
[1:07:40] broadcaster turbo GreatSphynx: pecker, beaver, same dif 
[1:07:44] SushiGummy: HUHH
[1:07:48] Blocknight1: what a kook 
[1:07:49] subscriber AgentAtaraxia: 'Haha, Grandpa is senile!' 
[1:07:49] Duckiestrides: dilf counter: 1 
[1:07:54] Duckiestrides: WAIT 
[1:07:56] hillbillyinablimp: that tree has cheeks 
[1:07:58] Duckiestrides: 2 I MEAN 2 
[1:08:01] glitchcon2020 Lyzerus: Douglath 
[1:08:05] subscriber twitch-recap-2023 Piyokopyo: pbffffttt 
[1:08:07] vip Babbott_Orion: based granpa 
[1:08:07] bits nyeaszel: D:
[1:08:10] subscriber AgentAtaraxia: GRANDPA BERMAD
[1:08:11] subscriber snosa: asshat 
[1:08:11] DumboAKAwumbo: Grandpa broke several bones odoNo
[1:08:12] superultracombo-2023 ultrahuhwhat: spanken 
[1:08:15] SushiGummy: D:
[1:08:17] mick_sq: SPANKENHEIMER 
[1:08:18] subscriber twitch-recap-2023 Piyokopyo: greats8Bermus
[1:08:18] 22seff22: There goes the Christmas tree 
[1:08:23] glitchcon2020 Lyzerus: BERMAN
[1:08:29] Blocknight1: me in the oppenheimer showing 
[1:08:29] subscriber AgentAtaraxia: tendiAAH
[1:08:30] AnodyneVS: WHO 
[1:08:30] subscriber malty_meatia: AUSTIN POWERS 
[1:08:30] subscriber superultracombo-2023 D_tector008: @TheTragicomical she serving looks tho 
[1:08:33] machine_head: austin bucks, ceo of own all 
[1:08:33] twitch-recap-2023 Annonn140: WHAT
[1:08:36] superultracombo-2023 Mauri_64: LIQUID 
[1:08:37] vip premium plorf: business man 
[1:08:37] Duckiestrides: capitalism 
[1:08:38] subscriber twitch-recap-2023 n0tthedoctor: Richoid 
[1:08:38] subscriber solberserker: this kid has such a punchable face 
[1:08:39] vip GodliestCat64: SNAAAAAKE BERMAD
[1:08:42] subscriber snosa: odoLUL
[1:08:43] Creatures_Features: kek 
[1:08:43] superultracombo-2023 ultrahuhwhat: u wanna own... my grandma 
[1:08:43] sylvaleaf: John Dollars 
[1:08:44] SushiGummy: so he can... own her? 
[1:08:46] bits nyeaszel: odoLUL
[1:08:47] Takamatsu2: john capitoloid 
[1:08:50] vip Trageenomical: @D_tector008 servin' scarlet envy 
[1:08:53] twitch-recap-2023 Blank_Dogton: ELFENHEIMER 
[1:08:54] Solbiaa: :tf:
[1:08:55] twitch-recap-2023 Annonn140: :tf:
[1:08:56] superultracombo-2023 ultvir: :tf:
[1:09:00] mick_sq: :tf:
[1:09:00] subscriber solberserker: My le reindeer... 
[1:09:05] subscriber snosa: :tf:
[1:09:08] subscriber malty_meatia: Ya gotta pay the troll toll to get in! 
[1:09:13] testicle_torsion: gigachad Grandma 
[1:09:14] subscriber superultracombo-2023 D_tector008: Now she is become Elf, destroyer of christmas 
[1:09:15] subscriber AgentAtaraxia: odoAWOOGA
[1:09:15] vip artist-badge Guardison: BERMUS kaching 
[1:09:18] bits nyeaszel: BERMUS $$$ 
[1:09:20] subscriber sofasofia: money <3
[1:09:23] sub-gift-leader divind95: sidewalk santa? 
[1:09:27] vip Trageenomical: BERMUS hehe caching 
[1:09:28] BLCeee: fax machines LUL
[1:09:30] Solbiaa: $$ vineGreed
[1:09:30] subscriber JoGoBeans: EMAIL 
[1:09:31] AnodyneVS: Their modern fax machines 
[1:09:33] Spie812: phone bad 
[1:09:34] macil_tech: sidewalk santas are big business 
[1:09:35] Duckiestrides: get im girl 
[1:09:36] subscriber sofasofia: shaking fist at fax machine 
[1:09:38] bits nyeaszel: odoNo
[1:09:39] broadcaster turbo GreatSphynx: wideHUH
[1:09:42] broadcaster turbo GreatSphynx: slay mobile 
[1:09:42] subscriber superultracombo-2023 D_tector008: who needs subtlety 
[1:09:43] subscriber AgentAtaraxia: Fax machines and avacado toast and inflatable trees 
[1:09:44] VRJosh: Grandma got all the STRONG DOMINANT Genes 
[1:09:44] glitchcon2020 Lyzerus: Raiden 
[1:09:45] subscriber snosa: slay mobile 
[1:09:46] bits nyeaszel: yaaas slay 
[1:09:46] mick_sq: Sled 2 
[1:09:47] subscriber sofasofia: slay. 
[1:09:48] sub-gift-leader divind95: slay mobile 
[1:09:49] subscriber superultracombo-2023 D_tector008: SLAY MAMA 
[1:09:49] Boscodbear: slay girl 
[1:09:50] AnodyneVS: I remember when people would interact with each other instead of stare at their fax machines all day 
[1:09:55] SoCosion: slay mama 
[1:09:57] premium goldwolf128: what a bazzro world 
[1:09:59] aimlessdemon: cross eyed 
[1:10:01] subscriber superultracombo-2023 D_tector008: did you see his eyes 
[1:10:02] vera_azure: OH SHIT THAT'S CAM CLARKE! 
[1:10:09] testicle_torsion: @vrjosh DO YOU KNOW WHAT ITS LIKE KNOWING YOURE TRASH 
[1:10:10] subscriber AgentAtaraxia: All kids do is fax machine, inflatable tree, ca-ching and lie 
[1:10:12] sub-gift-leader divind95: she has a point 
[1:10:14] subscriber snosa: Stare
[1:10:14] 22seff22: This guy is kind of reminding me of Miller from mgs1 
[1:10:15] subscriber HexenHell: on the 26th day of christmas, my Gongo gave to meeeee: Grandma not wanted to sell Hottie looking at his bulge of money Kid believes on santa Peoples...with....cellphoooooones! 
[1:10:15] vip GodliestCat64: Grandma you ENJOY Christmas odoCrunge
[1:10:16] premium Syluxrox: damn she kinda a baddie 
[1:10:19] vera_azure: DID YOU LIKE MY SUNGLASSES? 
[1:10:22] subscriber snosa: eheu 
[1:10:23] subscriber AgentAtaraxia: BERMUS
[1:10:24] vip artist-badge Guardison: BERMUS
[1:10:25] bits nyeaszel: BERMAN
[1:10:26] twitch-recap-2023 Annonn140: BERMUS
[1:10:27] turbo nivis_shadoth: odoAWOOGA
[1:10:27] glitchcon2020 Lyzerus: BERMUS
[1:10:28] subscriber twitch-recap-2023 Piyokopyo: mel BERMAN
[1:10:29] SushiGummy: BERMUS
[1:10:31] superultracombo-2023 ultvir: BERMAD
[1:10:33] subscriber superultracombo-2023 D_tector008: @TheTragicomical ok shes an icon 
[1:10:33] Blocknight1: BERMUS
[1:10:34] subscriber partner Temiree: greats8Bermus
[1:10:37] subscriber superultracombo-2023 D_tector008: CINCHED 
[1:10:37] Creatures_Features: bitch get a job 
[1:10:40] subscriber AgentAtaraxia: Retirement ruined 
[1:10:41] subscriber twitch-recap-2023 n0tthedoctor: 2020Suspicious 2020Suspicious 2020Suspicious 2020Suspicious
[1:10:44] vip Trageenomical: @D_tector008 she's always been an icon, she is a queen 
[1:10:44] sub-gift-leader divind95: so is this his aunt or something 
[1:10:49] superultracombo-2023 ultrahuhwhat: cork up daphne 
[1:10:53] subscriber superultracombo-2023 D_tector008: @A_Dead_Account with a cinched waist like that she dont need to 
[1:11:01] twitch-recap-2023 wallacewellactually: cousin mel im going to send you to the SHADOW REALM 
[1:11:02] Creatures_Features: lol 
[1:11:04] subscriber sub-gifter maxzlock: oh yeah! 
[1:11:06] sub-gift-leader divind95: RAGEY
[1:11:09] bits nyeaszel: u are expicitly removed from the will 
[1:11:12] nibblenippler: honestly, work. 
[1:11:12] testicle_torsion: *runs 3 feet away* 
[1:11:18] subscriber superultracombo-2023 D_tector008: not anymore 
[1:11:26] sub-gift-leader divind95: run a business on goodwill? In this economy? odoLUL
[1:11:29] Duckiestrides: she rly needs to get a different job 
[1:11:32] subscriber sub-gifter maxzlock: Bezos won peepoSad
[1:11:33] subscriber snosa: catPls
[1:11:34] subscriber superultracombo-2023 D_tector008: the normal ones you mean 
[1:11:34] subscriber AgentAtaraxia: People who have money and those that do not 
[1:11:35] subscriber JoGoBeans: catPls
[1:11:35] subscriber premium Kythuulu: catPls
[1:11:35] vip artist-badge Guardison: catPls
[1:11:36] subscriber twitch-recap-2023 Piyokopyo: catPls
[1:11:37] sub-gift-leader divind95: catPls
[1:11:38] subscriber AgentAtaraxia: catPls
[1:11:40] BLCeee: catPls
[1:11:41] vip Babbott_Orion: catPls
[1:11:41] twitch-recap-2023 franceybear: catPls
[1:11:43] subscriber sofasofia: catPls
[1:11:43] SushiGummy: jarJAM
[1:11:46] twitch-recap-2023 Annonn140: KKona GuitarTime
[1:11:48] subscriber twitch-recap-2023 n0tthedoctor: Chilllreaan 
[1:11:49] xx_noobslaya_xx: catPls
[1:11:50] subscriber partner Temiree: ALLAMARAINE ALLAMARAINE ALLAMARAINE
[1:11:51] subscriber AgentAtaraxia: sweatFrogM
[1:11:53] subscriber twitch-recap-2023 Piyokopyo: NOOOO
[1:11:54] Blocknight1: monkaS
[1:12:00] subscriber twitch-recap-2023 n0tthedoctor: greats8Bruh
[1:12:01] subscriber snosa: ALLAMARAINE
[1:12:02] premium X_eroz: So grandma was run over by a hitman santa who was hired by the corpa guy greats8YoTrip
[1:12:10] salad_snack_: we'll never escape the tyranny of christmas fruitcake 
[1:12:11] subscriber snosa: beef jenky 
[1:12:11] vip premium plorf: KKona
[1:12:14] vip twitch-recap-2023 blaseGraham: ALLAMARAINE
[1:12:16] SushiGummy: yeah they're setting up a whole conspiracy here 
[1:12:17] subscriber sofasofia: videochessNerves fruit cake 
[1:12:17] subscriber AgentAtaraxia: Haha skeleton 
[1:12:19] testicle_torsion: The world: The United States 
[1:12:24] vip GodliestCat64: lmao 
[1:12:26] subscriber hunnietoots: catPls
[1:12:26] Solbiaa: monkaS It kills 
[1:12:26] vip artist-badge Guardison: DOOFUS NOOOO
[1:12:27] broadcaster turbo GreatSphynx: doofus 
[1:12:27] vip GodliestCat64: Doofus 
[1:12:27] vip twitch-recap-2023 blaseGraham: The
[1:12:28] subscriber twitch-recap-2023 Piyokopyo: The
[1:12:28] Bladestorm01: Sponsor by BIG FRUIT CAKE 
[1:12:29] sub-gift-leader divind95: doofus 
[1:12:31] vip premium lmaoboat: This lady has 160 results on rule 34 
[1:12:36] subscriber AgentAtaraxia: Poison fruitcakes 
[1:12:37] broadcaster turbo GreatSphynx: wideHUH
[1:12:40] broadcaster turbo GreatSphynx: wtf poisoning 
[1:12:41] subscriber twitch-recap-2023 Piyokopyo: needs more 
[1:12:41] Solbiaa: D:
[1:12:44] premium goldwolf128: felony 
[1:12:45] vip artist-badge Guardison: rat poison 
[1:12:47] BLCeee: D: CRIME 
[1:12:47] subscriber snosa: felony 
[1:12:48] subscriber AgentAtaraxia: Hang on 
[1:12:48] Creatures_Features: actually evil wtf 
[1:12:48] twitch-recap-2023 Annonn140: monkaS
[1:12:49] SushiGummy: *poisons entire family* 
[1:12:53] subscriber AgentAtaraxia: That makes no sense 
[1:13:02] testicle_torsion: I think she may be an antagonist 
[1:13:02] macil_tech: sacrifices must be made 
[1:13:03] Duckiestrides: daphne no 
[1:13:06] subscriber malty_meatia: Gampa an Ganma 
[1:13:06] subscriber partner Temiree: Kill customers so you can take over the store and then have no one to sell anything to 
[1:13:14] subscriber AgentAtaraxia: So is the kid gonna tell someone or...? 
[1:13:15] testicle_torsion: God I wish she would poison me 
[1:13:15] VRJosh: Make the cousin eat ALL the fruitcake 
[1:13:18] sub-gift-leader divind95: that's not how it works grandma 
[1:13:21] twitch-recap-2023 GigiWuzHere_: Dang, Daphne from Scooby Doo turned out to be a bitch 
[1:13:23] subscriber sub-gifter maxzlock: thats called foreshadowin kids 
[1:13:23] testicle_torsion: sorry 
[1:13:34] machine_head: @Temiree she wants to sell the plot of land to Austin Bucks, ceo of Own All Corporation 
[1:13:35] broadcaster turbo GreatSphynx: odoPat
[1:13:37] SushiGummy: bold of you to think grandma hasn't built up resistance to most poisons 
[1:13:37] subscriber twitch-recap-2023 Piyokopyo: grandma no it's laced with nitroglyverin NOOOO
[1:13:39] hillbillyinablimp: went looking for my meds, found christmas decorations 
[1:13:42] sylvaleaf: wait she never took her pills 
[1:13:45] subscriber AgentAtaraxia: Grandma too stronk for poison 
[1:13:55] twitch-recap-2023 GigiWuzHere_: Too sweet 
[1:13:56] subscriber AgentAtaraxia: On the nose alright 
[1:13:59] subscriber superultracombo-2023 D_tector008: this movie is on the nose 
[1:14:05] premium enfecalfication: i just got back, is that jerma? 
[1:14:09] subscriber snosa: boop 
[1:14:12] Creatures_Features: <3
[1:14:12] subscriber partner Temiree: @machine_head oh mb 
[1:14:17] subscriber superultracombo-2023 D_tector008: @Zeplin666 as a youngin 
[1:14:23] bits LLugnuto779: 18 raiders from LLugnuto779 have joined! 
[1:14:23] MrBoo809: davekaJer davekaMa
[1:14:25] Bladestorm01: And he hit me on a drive by 
[1:14:25] sub-gift-leader divind95: Sleepo
[1:14:27] subscriber snosa: gondaL
[1:14:28] subscriber AgentAtaraxia: It a lug 
[1:14:29] subscriber JoGoBeans: catPls
[1:14:30] hexam_project: lol 
[1:14:32] Dust1210: catPls
[1:14:32] twitch-recap-2023 Fireborn: HUHH
[1:14:32] machine_head: spoilers 
[1:14:33] vip artist-badge Guardison: catPls
[1:14:33] subscriber twitch-recap-2023 Piyokopyo: catPls
[1:14:33] twitch-recap-2023 GigiWuzHere_: catPls
[1:14:33] superultracombo-2023 rattletrap69: OMFG I SAW THE THUMBNAIL, I HAD to come over, COUSIN MEL CAN GET IT B)
[1:14:33] SushiGummy: daxMug raid 
[1:14:34] subscriber snosa: merry chrismn 
[1:14:34] subscriber sofasofia: catPls
[1:14:34] subscriber premium Kythuulu: spoilers 
[1:14:35] vip GodliestCat64: catPls
[1:14:35] bits LLugnuto779: greats8MornReal
[1:14:37] vip premium VirtuaLiteXP: catPls
[1:14:37] subscriber premium neffpls: catPls
[1:14:37] vip premium plorf: catPls
[1:14:38] sub-gift-leader divind95: grandma got those kicks 
[1:14:39] twitch-recap-2023 Annonn140: KKona GuitarTime
[1:14:39] Bladestorm01: DinoDance DinoDance DinoDance DinoDance DinoDance DinoDance
[1:14:39] BLCeee: its time 
[1:14:40] hexam_project: are you playing that song from yesterday 
[1:14:42] subscriber sofasofia: gramma got the fit 
[1:14:42] superultracombo-2023 Mauri_64: catPls
[1:14:43] subscriber snosa: catPls
[1:14:43] macil_tech: countdown to rip 
[1:14:44] hexam_project: or the otehr day 
[1:14:44] xhiggy: catPls
[1:14:44] SushiGummy: catPls
[1:14:48] glitchcon2020 Lyzerus: quarkPls
[1:14:50] subscriber malty_meatia: catPls
[1:14:52] subscriber AgentAtaraxia: Uh oh
[1:14:54] mick_sq: BBoomer BBoomer
[1:15:00] superultracombo-2023 Mauri_64: oh boy here it comes 
[1:15:02] subscriber snosa: lol 
[1:15:03] vip GodliestCat64: She'd been drinking too much eggnog 
[1:15:05] BLCeee: LUL
[1:15:05] twitch-recap-2023 GigiWuzHere_: Why doesn't someone offer to drive her 
[1:15:05] subscriber superultracombo-2023 D_tector008: LUL
[1:15:06] vip artist-badge Guardison: lmao 
[1:15:09] premium goldwolf128: bazzo world 
[1:15:10] vip GodliestCat64: And she'd been drinking too much eggnog 
[1:15:10] SushiGummy: NOOOO GRANDMA NO 
[1:15:11] vip GodliestCat64: Funnywhitecat5
[1:15:13] subscriber malty_meatia: We're begging! 
[1:15:14] twitch-recap-2023 Fireborn: deadass
[1:15:14] subscriber solberserker: "eggnog" 
[1:15:15] Artacus: grandma is plastered 
[1:15:16] mick_sq: monkaS
[1:15:16] subscriber snosa: dataBye
[1:15:18] subscriber AgentAtaraxia: Grannys wasted 
[1:15:20] superultracombo-2023 ultvir: staggered 
[1:15:22] Creatures_Features: T_T grandmaaaa 
[1:15:23] twitch-recap-2023 GigiWuzHere_: Crosher
[1:15:24] vip premium plorf: too much rum 
[1:15:24] subscriber sofasofia: grandma nooo 
[1:15:25] premium goldwolf128: :O
[1:15:26] subscriber superultracombo-2023 D_tector008: theres a thing called show, dont tell(twice) 
[1:15:28] twitch-recap-2023 dringoose: always have the eggnog before your regular medication 
[1:15:33] superultracombo-2023 ultvir: grandma off the nog 
[1:15:33] superultracombo-2023 rattletrap69: he really said :y 
[1:15:34] subscriber malty_meatia: :° 
[1:15:35] hexam_project: grandma drank the entire liquor cabinent 
[1:15:35] SushiGummy: she got hit the MOMENT she stepped outside 
[1:15:37] subscriber snosa: catPls
[1:15:41] subscriber JoGoBeans: it's heem OYOTrip
[1:15:41] subscriber AgentAtaraxia: ITS HIM 
[1:15:41] subscriber twitch-recap-2023 Piyokopyo: GET A LOAD 
[1:15:42] subscriber AgentAtaraxia: MR KILL 
[1:15:43] glitchcon2020 Lyzerus: Dead 
[1:15:43] sub-gift-leader divind95: odoLUL dead 
[1:15:43] vip artist-badge Guardison: NOOOO
[1:15:44] vip GodliestCat64: LMAO 
[1:15:44] vip premium plorf: grandma gets spawkilled by santa 
[1:15:45] subscriber AgentAtaraxia: WorfPls
[1:15:45] mick_sq: GRANDMA'S DIED 
[1:15:45] subscriber premium Kythuulu: DEAD 
[1:15:46] Bladestorm01: BRIAN LOOK UP 
[1:15:47] Creatures_Features: lmfao 
[1:15:47] BLCeee: MR KILL 
[1:15:47] Blocknight1: D:
[1:15:47] subscriber solberserker: NOOOOO 
[1:15:48] Hot_Samson: OH MY GOD 
[1:15:48] vip artist-badge Guardison: fucking FLATTENED 
[1:15:48] premium enfecalfication: mortis 
[1:15:49] aimlessdemon: OMEGALYL 
[1:15:49] premium Syluxrox: syadouOmegaLUL
[1:15:49] twitch-recap-2023 Annonn140: LUL
[1:15:49] turbo nivis_shadoth: deadass
[1:15:49] subscriber partner Temiree: dead temireClap
[1:15:49] subscriber snosa: wasted 
[1:15:50] SushiGummy: NOOOO
[1:15:50] Pretendeer: holy shit 
[1:15:50] vip GodliestCat64: GRANDMA NOOOO
[1:15:50] premium nickynack: DIESOFCRINGE
[1:15:50] testicle_torsion: grandma. your eggnog too strong, your shop too generous, THEYLL FUCKING KILL YOU 
[1:15:51] premium Iceckryss: FUCKING DEAD 
[1:15:51] vip Trageenomical: trauma 
[1:15:52] subscriber twitch-recap-2023 carlysle_: LUL
[1:15:52] premium Syluxrox: fucking DEAD 
[1:15:52] vip premium plorf: NOOOO
[1:15:53] twitch-recap-2023 GigiWuzHere_: His fault for believing D:
[1:15:53] subscriber premium KamiGousama: GET A LOAD OF THIS
[1:15:54] subscriber malty_meatia: Pummeled 
[1:15:54] subscriber solberserker: DEAD 
[1:15:54] subscriber twitch-recap-2023 n0tthedoctor: GET A LOAD OF THIS
[1:15:55] Lastrin: DEADLUL 
[1:15:56] Artacus: the end 
[1:15:56] glitchcon2020 Lyzerus: GRANDMA HAS DIED vargFloss
[1:15:56] NarthexWulf: GET A LOAD OF THIS! 
[1:15:57] Bladestorm01: BRIAN LOOK OUT 
[1:15:57] Lastrin: LUL
[1:15:58] Solbiaa: Deadge 
[1:15:59] sylvaleaf: santa didn't even stop 
[1:15:59] superultracombo-2023 rattletrap69: @testicle_torsion lmao 
[1:16:00] macil_tech: santa does hit and runs 
[1:16:01] 22seff22: Not only did he run her over but he called her a hoe 
[1:16:01] subscriber AgentAtaraxia: GRANNY DEAD 
[1:16:05] subscriber snosa: WorfPls
[1:16:06] premium Iceckryss: SANTA MURDERED GRANDMA 
[1:16:06] Duckiestrides: GILF DOWN 
[1:16:11] premium Syluxrox: LET GRANDMA DIE CHILD 
[1:16:16] subscriber AgentAtaraxia: Holy shit what a crappy family 
[1:16:17] Hot_Samson: granny didnt get ran over granny got what she deserved 
[1:16:21] bits LLugnuto779: i sleep 
[1:16:23] subscriber malty_meatia: Yoouwa 
[1:16:27] macil_tech: she's dying right now 
[1:16:32] sub-gift-leader divind95: why the fuck is cousin mel here 
[1:16:33] subscriber twitch-recap-2023 Piyokopyo: granny was jay walking 
[1:16:34] superultracombo-2023 rattletrap69: AWOOOOOGA 
[1:16:34] subscriber partner Temiree: HUHH
[1:16:34] bits LLugnuto779: https://cdn.discordapp.com/attachments/913241374239887451/1189121109812056174/image0.png?ex=659d0255&is=658a8d55&hm=da1d2a78b40607c40e6dd40a0f6d446868cf955a3bfed0e517b40d9916e84956& 
[1:16:35] Artacus: booba 
[1:16:36] AnodyneVS: Getting his story straight to testify against Santa in court 
[1:16:38] subscriber AgentAtaraxia: AWOOGA-ITIS 
[1:16:39] twitch-recap-2023 GigiWuzHere_: Meanwhile Grandma deadass
[1:16:40] Lastrin: WOAH 
[1:16:42] Lastrin: D:
[1:16:42] SushiGummy: anyway we don't have the time to look out the front door, sport 
[1:16:43] sub-gift-leader divind95: "Your son is delusional" 
[1:16:46] Bladestorm01: SHes bleeding out 
[1:16:47] subscriber twitch-recap-2023 ocarina_boy: lmao llug 
[1:16:49] twitch-recap-2023 dringoose: Isn't that the disney mermaid character 
[1:16:52] subscriber snosa: lol llug 
[1:16:57] vip premium plorf: TREKW
[1:16:59] subscriber malty_meatia: YES! 
[1:16:59] testicle_torsion: YES 
[1:17:02] subscriber premium Kythuulu: YES 
[1:17:03] twitch-recap-2023 Professor_Pineapple_: odoLUL
[1:17:03] glitchcon2020 Lyzerus: Grandpa's FUCKING POIGGING 
[1:17:03] twitch-recap-2023 GigiWuzHere_: He's not even concerned 
[1:17:04] subscriber twitch-recap-2023 Piyokopyo: are u gonna help her? 
[1:17:04] macil_tech: gg grandma no re 
[1:17:04] superultracombo-2023 ultvir: that's your wife 
[1:17:04] vip GodliestCat64: TREKW
[1:17:06] machine_head: shes freezin to death :)
[1:17:07] glitchcon2020 Lyzerus: Pogging) 
[1:17:08] subscriber sofasofia: bruh 
[1:17:08] superultracombo-2023 Mattmatatt: is she still out in the cold??? 
[1:17:08] premium Syluxrox: hes so happy grandma got fucking killed wtf 
[1:17:08] subscriber AgentAtaraxia: Grandpa is NOT right 
[1:17:11] 22seff22: Yall grandma is dead 
[1:17:13] Lastrin: THATS YOUR WIFE 
[1:17:14] subscriber premium KamiGousama: you didn't help her? 
[1:17:15] twitch-recap-2023 GigiWuzHere_: DIESOFCRINGE
[1:17:16] SushiGummy: grandpa is LOVING this 
[1:17:21] broadcaster turbo GreatSphynx: DIESOFCRINGE
[1:17:25] turbo nivis_shadoth: why is no one trying to help her? 
[1:17:28] twitch-recap-2023 GigiWuzHere_: Omg 
[1:17:29] AnodyneVS: She got hit and grandpa just took a big sip and went "yep." 
[1:17:29] subscriber malty_meatia: The wolves got her 
[1:17:35] SushiGummy: *doesn't look down 10 degrees* 
[1:17:39] subscriber snosa: NOOOO
[1:17:40] premium Iceckryss: Your wife is dead you dumb moron 
[1:17:41] subscriber AgentAtaraxia: Holy shit this kids voice 
[1:17:43] twitch-recap-2023 GigiWuzHere_: HURRY 
[1:17:46] vip GodliestCat64: dataBruh
[1:17:48] twitch-recap-2023 Annonn140: bro just look outside 
[1:17:51] subscriber AgentAtaraxia: Yes, we've been drinking 
[1:17:56] moderator turbo Dragoneye77: SPHYNX 
[1:17:56] subscriber twitch-recap-2023 Piyokopyo: sir this is an emergency line 
[1:17:58] Artacus: fargo reference? 
[1:17:58] broadcaster turbo GreatSphynx: so iuhh frozen corpse 
[1:17:59] glitchcon2020 Lyzerus: Don'tcha know 
[1:17:59] subscriber partner Temiree: Fargo lol 
[1:18:00] moderator turbo Dragoneye77: HOW COULD YOU DO THIS WITHOUT TELLING ME 
[1:18:01] superultracombo-2023 rattletrap69: young meyn 
[1:18:01] subscriber sofasofia: fargo cops 
[1:18:07] subscriber snosa: WHAT
[1:18:08] SushiGummy: is there not a body?? 
[1:18:12] moderator turbo Dragoneye77: this is peak gongo
[1:18:15] vip Trageenomical: should've just told them she was run ove rby a car 
[1:18:15] subscriber AgentAtaraxia: wtf 
[1:18:16] premium Syluxrox: donchakno 
[1:18:16] 22seff22: Umm reindeer exist 
[1:18:17] xhiggy: why does everyone suck so much 
[1:18:17] twitch-recap-2023 GigiWuzHere_: Fargo police 
[1:18:18] subscriber premium KamiGousama: MANUAL?? 
[1:18:20] VRJosh: was she a Fargo reference? 
[1:18:21] Duckiestrides: or reindeer 
[1:18:23] subscriber snosa: lmfao 
[1:18:24] Hot_Samson: why do the trees look like that? 
[1:18:24] SushiGummy: catPls
[1:18:26] subscriber AgentAtaraxia: These cops are just as useful as the real life ones 
[1:18:26] moderator turbo Dragoneye77: fucking dead 
[1:18:27] moderator game-developer DaveKap: this is so fucked up 
[1:18:29] testicle_torsion: boonAugh
[1:18:29] AnodyneVS: lmao 
[1:18:29] Bladestorm01: DEAD FROZEN CORPSE 
[1:18:30] Hot_Samson: They have white outlines but are also bare of leaves 
[1:18:31] subscriber solberserker: Shes DEAD 
[1:18:31] subscriber sofasofia: evidence... 
[1:18:32] Creatures_Features: lmao 
[1:18:33] machine_head: @xhiggy the town is owned by Own All Corporation 
[1:18:35] sub-gift-leader divind95: lmao 
[1:18:35] Artacus: claws marks 
[1:18:35] subscriber JoGoBeans: song's not matching up 
[1:18:37] testicle_torsion: @davekap hi
[1:18:37] premium Iceckryss: Santa stole the corpse 
[1:18:38] moderator founder turbo Dragoneye77: Dragoneye77 subscribed with Prime. They've subscribed for 58 months! 
[1:18:40] subscriber snosa: ooooo yaaaaaa 
[1:18:40] twitch-recap-2023 GigiWuzHere_: She's not there wideHUH
[1:18:42] turbo nivis_shadoth: but they didn't find her? 
[1:18:45] Boscodbear: grandma's DEAD and they think it's a joke 
[1:18:45] vip Snudl: catPls Grandma is dead catPls
[1:18:45] moderator game-developer DaveKap: doofus 
[1:18:47] subscriber premium Kythuulu: doofus 
[1:18:47] superultracombo-2023 rattletrap69: dog :)
[1:18:48] Pretendeer: doofus 
[1:18:49] Hot_Samson: seriously wtf going on with the trees 
[1:18:50] moderator founder turbo Dragoneye77: what kind of asshole names their dog that 
[1:18:52] Bladestorm01: Kidnapped 
[1:18:54] broadcaster turbo GreatSphynx: those are her bones 
[1:18:57] premium X_eroz: Already eaten by wolves 
[1:19:00] BLCeee: grandma has died D:
[1:19:01] VRJosh: That's her corpse monkaS
[1:19:02] vip twitch-recap-2023 viahate: naming a dog doofus is so fucked up LUL
[1:19:02] sub-gift-leader divind95: lol sphynx 
[1:19:03] premium enfecalfication: did they just leave her out there 
[1:19:05] subscriber malty_meatia: Doofus Spankenheimer 
[1:19:05] subscriber snosa: deadass
[1:19:05] Bladestorm01: Her frozen corspe 
[1:19:06] sylvaleaf: "this is my dog, his name is stupid idiot" 
[1:19:09] twitch-recap-2023 GigiWuzHere_: Song got it wrong D:
[1:19:12] Artacus: nobody gives a shit 
[1:19:12] macil_tech: they were annoyingly literal with the song until this point. not sure if I'm relieved they dropped that or annoyed at the inconsistency 
[1:19:18] premium goldwolf128: even if they dont believe in santa they should at least be concerned someone did a hit and run 
[1:19:23] grandfatigue: in heat 
[1:19:23] Boscodbear: dog tampering evidence, throw the case out 
[1:19:27] Solbiaa: Grandma had those bug's fruitcake! D:
[1:19:30] machine_head: this guys an android 
[1:19:30] testicle_torsion: “capable of flight” 
[1:19:32] Creatures_Features: why is no one watching this walking sus , he pelot armour is strunk 
[1:19:32] subscriber snosa: ooooookey then 
[1:19:36] moderator game-developer DaveKap: this fargo joke lmao 
[1:19:37] subscriber premium KamiGousama: this guy is good 
[1:19:39] testicle_torsion: Detroit Become Elf 
[1:19:41] SushiGummy: LUL
[1:19:42] twitch-recap-2023 GigiWuzHere_: 🍑 
[1:19:49] Duckiestrides: SLIEHICULAR... 
[1:19:55] moderator founder turbo Dragoneye77: santa deniers 
[1:19:59] vip artist-badge Guardison: broad 
[1:20:03] subscriber solberserker: Santa deniers 
[1:20:03] BLCeee: D: DAMN 
[1:20:04] Boscodbear: hit n run followed by a kidnapping 
[1:20:08] Creatures_Features: ....i think I had too much eggnog >.>'' forget that last sentence 
[1:20:09] subscriber snosa: peepoSad
[1:20:13] Duckiestrides: old brad 
[1:20:17] twitch-recap-2023 GigiWuzHere_: wideHUH
[1:20:18] premium nickynack: months WHAT
[1:20:19] vip twitch-recap-2023 viahate: hunting grandmas crumpSnipe
[1:20:21] Artacus: if they had just listened 
[1:20:26] superultracombo-2023 sofamire: oh dam this one is actually a banger of a movie. I watched it as a kid 
[1:20:27] vera_azure: https://youtu.be/we0Dk3mMPc0 
[1:20:28] twitch-recap-2023 dringoose: i'd search granny's cranny 
[1:20:32] Duckiestrides: jesus christ 
[1:20:36] subscriber premium KamiGousama: chat pls 
[1:20:37] broadcaster turbo GreatSphynx: cope 
[1:20:38] subscriber snosa: slay holy shit 
[1:20:38] glitchcon2020 Lyzerus: Santa deniers. agentr13VomNow
[1:20:38] moderator founder turbo Dragoneye77: cope 
[1:20:40] subscriber robotsnake: cope 
[1:20:41] vip subscriber twitch-recap-2023 Whats_Aleppo: I loved this movie limesPoggers
[1:20:47] twitch-recap-2023 Annonn140: odoPain
[1:20:48] subscriber malty_meatia: How do we settle the poll 
[1:20:53] subscriber JoGoBeans: NOOOO
[1:20:53] premium nickynack: odoPain
[1:20:53] moderator founder turbo Dragoneye77: agentr13VomNow SANTA DENIERS OUT agentr13VomNow
[1:20:59] Duckiestrides: why is his sister friggin smilin 
[1:21:00] macil_tech: I hope it goes like a horror movie with Santa killing more and more of these characters 
[1:21:01] subscriber twitch-recap-2023 Piyokopyo: why is this even a poll 
[1:21:05] superultracombo-2023 Mauri_64: LIQUID 
[1:21:05] subscriber twitch-recap-2023 Piyokopyo: there's non believers here? 
[1:21:06] vip artist-badge Guardison: BERMUS
[1:21:06] moderator founder turbo Dragoneye77: why not 
[1:21:09] Boscodbear: she conspired to kill grandma 
[1:21:11] twitch-recap-2023 Annonn140: BERMUS
[1:21:11] subscriber twitch-recap-2023 Piyokopyo: find them 
[1:21:21] subscriber twitch-recap-2023 Piyokopyo: daxKill
[1:21:31] moderator founder bassclefff: this is a christmas movie 
[1:21:34] premium blackmoldbathtub420: why would Daphne want grandma dead 
[1:21:35] subscriber snosa: yes 
[1:21:36] sub-gift-leader divind95: Forged 
[1:21:44] superultracombo-2023 sofamire: evil daphnie 
[1:21:46] moderator founder turbo Dragoneye77: no vote actually tells santa your exact address 
[1:21:47] twitch-recap-2023 GigiWuzHere_: This is what happened after the Scooby Doo gang broke up odo 
[1:21:48] moderator founder turbo Dragoneye77: and then he will come 
[1:21:51] subscriber robotsnake: Holy fuck just realized thats Cam Clarke 
[1:21:55] BLCeee: banger incoming 
[1:21:56] subscriber robotsnake: LIQUIIIID 
[1:21:57] moderator founder turbo Dragoneye77: !blows 
[1:21:57] moderator partner Nightbot: https://i.imgur.com/uKc91Bl.png 
[1:21:58] twitch-recap-2023 GigiWuzHere_: odoNo
[1:22:04] SushiGummy: "depressed" 
[1:22:04] bits nyeaszel: odoNo
[1:22:06] subscriber premium KamiGousama: what 
[1:22:12] moderator founder turbo Dragoneye77: !pat 
[1:22:12] moderator partner Nightbot: spunX osmoPat
[1:22:13] Artacus: i'd rather sing 
[1:22:13] macil_tech: they should bring the rest of the scooby gang here to investigate the murder and unmask Santa 
[1:22:16] vip artist-badge Guardison: papaPlz
[1:22:17] subscriber twitch-recap-2023 ocarina_boy: lmao 
[1:22:17] superultracombo-2023 rattletrap69: sing? 
[1:22:18] subscriber malty_meatia: :3 
[1:22:19] subscriber premium Kythuulu: catPls
[1:22:20] moderator founder turbo Dragoneye77: KINO ALERT
[1:22:21] subscriber twitch-recap-2023 n0tthedoctor: LUL LUL LUL
[1:22:21] vip GodliestCat64: I love grandpa's song 
[1:22:22] subscriber JoGoBeans: catPls
[1:22:23] vip GodliestCat64: Funnywhitecat5
[1:22:23] twitch-recap-2023 GigiWuzHere_: wideHUH
[1:22:23] moderator founder turbo Dragoneye77: KINO ALERT
[1:22:24] twitch-recap-2023 Annonn140: LUL
[1:22:24] SushiGummy: ALLAMARAINE
[1:22:25] subscriber snosa: catPls
[1:22:25] subscriber premium KamiGousama: i love him 
[1:22:27] vip GodliestCat64: Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5
[1:22:27] vip artist-badge Guardison: catPls
[1:22:28] superultracombo-2023 rattletrap69: SourPls
[1:22:29] bits nyeaszel: funnywhitecat5 Funnywhitecat5 funnywhitecat5
[1:22:31] subscriber sofasofia: lynned1RAVEDEVIL lynned1RAVEDEVIL lynned1RAVEDEVIL
[1:22:31] premium cosmonaughtbob: greats8JAM
[1:22:31] subscriber robotsnake: catPls
[1:22:32] subscriber partner Temiree: ALLAMARAINE
[1:22:35] testicle_torsion: bro she might be dead 
[1:22:35] twitch-recap-2023 GigiWuzHere_: WHAT
[1:22:36] sub-gift-leader divind95: This is her eulogy ALLAMARAINE
[1:22:36] BLCeee: Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5
[1:22:37] moderator founder bassclefff: grandma is dead 
[1:22:41] superultracombo-2023 Mattmatatt: lmao 
[1:22:42] vip Trageenomical: dead 
[1:22:42] subscriber DerkieInTheDarkie: oh my god... 
[1:22:44] Lastrin: Grandpas got it 
[1:22:45] vip subscriber twitch-recap-2023 Whats_Aleppo: limesDance limesDance limesDance
[1:22:46] vip Snudl: catJammingPolitely
[1:22:46] moderator founder turbo Dragoneye77: Elvis died on the toilet 
[1:22:49] subscriber malty_meatia: GettingJiggyWithIt
[1:22:51] Duckiestrides: ViolinTime
[1:22:54] vip twitch-recap-2023 viahate: wtf old man boonAugh
[1:22:56] Creatures_Features: Big lipped alligator moment 
[1:22:58] broadcaster turbo GreatSphynx: these songs and stuff were originally made in like the 70s 
[1:22:59] subscriber AgentAtaraxia: what 
[1:23:03] moderator founder turbo Dragoneye77: grandpa cucked by elvis 
[1:23:05] MeltingCity3000: too old for elvis 
[1:23:05] twitch-recap-2023 GigiWuzHere_: What is going on 
[1:23:07] broadcaster turbo GreatSphynx: its amazed it lasted as long as it did 
[1:23:08] sub-gift-leader divind95: catPls
[1:23:11] twitch-recap-2023 GigiWuzHere_: bruleWhere
[1:23:12] broadcaster turbo GreatSphynx: im 
[1:23:12] Artacus: elvis was only 42 
[1:23:14] subscriber sofasofia: woa 
[1:23:14] vip artist-badge Guardison: Grandma no 
[1:23:15] Hot_Samson: UUUHHH 
[1:23:15] sub-gift-leader divind95: wideHUH
[1:23:15] subscriber snosa: :0 
[1:23:15] vip Trageenomical: UM 
[1:23:16] subscriber premium Kythuulu: wideHUH
[1:23:16] SushiGummy: HUHH
[1:23:19] vip subscriber twitch-recap-2023 Whats_Aleppo: limesBlink
[1:23:19] Boscodbear: grandma getting into some strange 
[1:23:22] subscriber partner Temiree: HUHH
[1:23:27] 22seff22: Grandpa you killed grandma admit it 
[1:23:33] moderator game-developer DaveKap: I feel like I loved it as a kid because it was an edgy christmas song during a holiday full of boring music 
[1:23:35] Artacus: stan lee 
[1:23:36] broadcaster turbo GreatSphynx: wideHUH
[1:23:41] sub-gift-leader divind95: wat 
[1:23:41] subscriber superultracombo-2023 D_tector008: @TheTragicomical she is thorough 
[1:23:43] subscriber snosa: NOOOO
[1:23:43] Hot_Samson: gramps is senile 
[1:23:47] moderator game-developer DaveKap: it was an easy to understand and remember song 
[1:23:49] subscriber sub-gifter maxzlock: grampa is coping well 
[1:23:49] subscriber DerkieInTheDarkie: are these like. real novelty songs? i thought they were just cynically trying to make a sequel to ran over 
[1:23:50] SushiGummy: dude grandpa is LOVING this 
[1:23:50] premium cosmonaughtbob: quarkHype
[1:23:51] Boscodbear: @Artacus atpRtsd atpRtsd atpRtsd
[1:23:51] moderator founder turbo Dragoneye77: why does fruit cake suck so much sphynx 
[1:23:57] subscriber snosa: lol 
[1:23:57] Takamatsu2: clueless 
[1:23:57] Blocknight1: LUL
[1:24:02] Artacus: it's a floor cake now 
[1:24:06] subscriber snosa: boing 
[1:24:07] superultracombo-2023 ultrahuhwhat: cake me 
[1:24:08] broadcaster turbo GreatSphynx: these people are all fucking dumb 
[1:24:09] twitch-recap-2023 GigiWuzHere_: 🥮 
[1:24:12] subscriber JoGoBeans: I've never had fruit cake and this movie made me hate them 
[1:24:14] moderator founder turbo Dragoneye77: well yeah 
[1:24:18] moderator founder turbo Dragoneye77: you're from like michigan 
[1:24:20] superultracombo-2023 rattletrap69: alright! 
[1:24:20] Crazybean42: My family has what must be a 70 year old fruit cake tin that constantly tempts me to open it. One of those call of the void situations. 
[1:24:22] moderator founder turbo Dragoneye77: theyre* 
[1:24:24] vip Trageenomical: @D_tector008 a true business woman 
[1:24:29] moderator founder turbo Dragoneye77: cheese brains 
[1:24:31] macil_tech: they're all so happy and kiddo wants to ruin it 
[1:24:31] Boscodbear: tl;dr 
[1:24:35] Bladestorm01: @greatsphynx that's a synopsis of this movie 
[1:24:37] sub-gift-leader divind95: that's realistically sad 
[1:24:40] mick_sq: Fruit cake can be actual garbage or heavenly depending on the maker. 
[1:24:41] subscriber superultracombo-2023 D_tector008: @TheTragicomical we stan 
[1:24:41] twitch-recap-2023 Annonn140: D:
[1:24:41] vip artist-badge Guardison: papaPlz Whoopsie 
[1:24:42] premium Iceckryss: kill her 
[1:24:44] subscriber premium Kythuulu: elder abuse 
[1:24:44] twitch-recap-2023 GigiWuzHere_: D:
[1:24:47] hexam_project: i would always eat the fruit cake 
[1:24:47] broadcaster turbo GreatSphynx: time for a car bomb 
[1:24:49] Boscodbear: does anyone even make fruitcakes anymore 
[1:24:50] subscriber BobbyHillPropaneDemigod: Crush her skull 
[1:24:56] subscriber snosa: lol 
[1:24:56] VRJosh: Whatever happened to all the fruitcake being poisoned? 
[1:24:56] kephyll: make her eat the fruit cake 
[1:24:58] subscriber JoGoBeans: SpeedSter
[1:24:59] sub-gift-leader divind95: gouge her eyes 
[1:24:59] turbo nivis_shadoth: brakes=cut 
[1:25:01] subscriber AgentAtaraxia: Cut her brakes kid 
[1:25:04] sub-gift-leader divind95: cut out her implants 
[1:25:05] premium Iceckryss: what about a vegetable cake 
[1:25:11] subscriber snosa: SpeedSter
[1:25:12] moderator founder turbo Dragoneye77: mister fucks office 
[1:25:12] twitch-recap-2023 GigiWuzHere_: Give the fruit cake to peewee 
[1:25:12] Takamatsu2: yeah fast 
[1:25:14] subscriber malty_meatia: I see fruitcakes at Walmart 
[1:25:15] subscriber snosa: skrrt 
[1:25:15] subscriber JoGoBeans: I heard that audio edit 
[1:25:20] subscriber AgentAtaraxia: They were pointing before he asked 
[1:25:22] superultracombo-2023 rattletrap69: YOU RIPPED UP MY CARPET KID 
[1:25:23] twitch-recap-2023 GigiWuzHere_: 👿 
[1:25:24] moderator founder turbo Dragoneye77: Its her 
[1:25:24] Hot_Samson: lobotomize her 
[1:25:27] Origfx: odoNo
[1:25:27] subscriber snosa: santa confirmed real 
[1:25:29] Bladestorm01: no security ? 
[1:25:29] premium DinnerCalzone: I Am Slime 
[1:25:30] twitch-recap-2023 Annonn140: pls PoroSad
[1:25:30] moderator founder turbo Dragoneye77: ITS HER 
[1:25:31] vip twitch-recap-2023 viahate: at this point, the whole family deserves to be swindled. idiots. RAGEY
[1:25:32] premium Iceckryss: kill her too 
[1:25:32] subscriber sofasofia: videochessDarkIntent SLIME 
[1:25:32] BLCeee: I Am Slime 
[1:25:34] vip GodliestCat64: I am Slime 
[1:25:34] subscriber premium Kythuulu: I am Slime 
[1:25:34] Creatures_Features: kek 
[1:25:35] vip Trageenomical: Love her 
[1:25:35] Origfx: GOOD NAME 
[1:25:37] sub-gift-leader divind95: I am Slime 
[1:25:39] Boscodbear: bezos buying whole foods 
[1:25:40] kephyll: this is yakuza 0 
[1:25:41] subscriber sub-gifter maxzlock: that coochie doin it for me slime 
[1:25:42] premium sougoe: Embrace the slime 
[1:25:44] subscriber partner Temiree: ... temireEgg
[1:25:46] subscriber malty_meatia: Slime anyone? 
[1:25:47] turbo nivis_shadoth: thanks for the pause. 
[1:25:49] broadcaster turbo GreatSphynx: wideHUH
[1:25:50] vip artist-badge Guardison: BERMUS
[1:25:50] subscriber twitch-recap-2023 Piyokopyo: greats8Bermus
[1:25:51] sub-gift-leader divind95: holy shit daphne 
[1:25:51] subscriber snosa: BERMUS
[1:25:51] vip GodliestCat64: BERMUS
[1:25:52] broadcaster turbo GreatSphynx: why is th is so horny 
[1:25:52] Dust1210: BERMUS
[1:25:52] Artacus: whoa 
[1:25:53] subscriber BingsF: this kid makes too many smirky faces, i'm on their side 
[1:25:54] twitch-recap-2023 Annonn140: BERMUS
[1:25:55] Blocknight1: BERMUS
[1:25:56] testicle_torsion: god I wish I was that deal 
[1:25:56] twitch-recap-2023 Fireborn: kids movie btw 
[1:25:57] Origfx: ayo... 
[1:25:57] subscriber twitch-recap-2023 Piyokopyo: boro why 
[1:25:58] subscriber twitch-recap-2023 carlysle_: BERMUS
[1:25:58] rplace-2023 netyuui: BERMUS
[1:25:59] Artacus: they just said that 
[1:26:00] Boscodbear: atpGasm
[1:26:00] twitch-recap-2023 GigiWuzHere_: HE'S gay 
[1:26:00] MrBoo809: davekaWAT
[1:26:01] turbo nivis_shadoth: odoAWOOGA
[1:26:01] Creatures_Features: what a bro 
[1:26:01] testicle_torsion: LMAO 
[1:26:03] subscriber sofasofia: lmfao 
[1:26:03] subscriber twitch-recap-2023 Piyokopyo: why would you turn that down 
[1:26:03] vip Trageenomical: he's gay 
[1:26:04] subscriber partner Temiree: she grabbed hre tits 
[1:26:04] vip artist-badge Guardison: it gets a little worse sphynx 
[1:26:08] superultracombo-2023 sofamire: yarrD
[1:26:08] subscriber twitch-recap-2023 Piyokopyo: he HAS to be gay 
[1:26:08] TacoTittyTatas: damn she really fucked that up 
[1:26:18] superultracombo-2023 rattletrap69: :D
[1:26:23] subscriber AgentAtaraxia: This is the stupidest script 
[1:26:28] vip GodliestCat64: Just wait for THE song 
[1:26:31] twitch-recap-2023 GigiWuzHere_: Almost a year.. 
[1:26:38] kephyll: god THAT song 
[1:26:39] sub-gift-leader divind95: why is she such a b 
[1:26:42] subscriber twitch-recap-2023 Piyokopyo: hilarious that this is horny and was on cartoon network or whatever 
[1:26:45] Creatures_Features: it's beena year???? 
[1:26:47] broadcaster turbo GreatSphynx: hes gonna enlist 4chan to help him find santa 
[1:26:50] Origfx: yo is that sound blaster? 
[1:26:50] twitch-recap-2023 GigiWuzHere_: Why does she not care wideHUH
[1:26:57] subscriber sofasofia: doofus noises 
[1:26:57] superultracombo-2023 rattletrap69: DOOFUS :)
[1:26:57] Bladestorm01: or reddit 
[1:27:00] moderator game-developer DaveKap: yeah 4chan will dox santa 
[1:27:02] twitch-recap-2023 GigiWuzHere_: That's her grandma also 
[1:27:08] mlew84: omg thanks I’ve been looking for this for the last 2 weeks and Xmas is not complete without it 
[1:27:11] Bladestorm01: and fuck it up LUL
[1:27:13] SushiGummy: listen dumbass 
[1:27:14] subscriber JoGoBeans: @GigiWuzHere_ because ugh sisters RAGEY
[1:27:17] subscriber twitch-recap-2023 Piyokopyo: they don't need 4chan 
[1:27:18] macil_tech: @GreatSphynx he's in a pizza store's basement 
[1:27:20] superultracombo-2023 rattletrap69: gaming time 
[1:27:21] subscriber twitch-recap-2023 Piyokopyo: just get sniper wolf 
[1:27:21] sub-gift-leader divind95: This was before the internet was dox central 
[1:27:24] Origfx: LUL
[1:27:24] broadcaster turbo GreatSphynx: lol 
[1:27:24] subscriber malty_meatia: Thanks for cheering up Jake with stock dog sounds, Doofus 
[1:27:25] subscriber premium Kythuulu: TREKW
[1:27:25] BLCeee: LUL big email moment 
[1:27:26] subscriber snosa: lol 
[1:27:26] twitch-recap-2023 GigiWuzHere_: @JoGo_ odoNo
[1:27:27] subscriber solberserker: LMAO 
[1:27:27] vip artist-badge Guardison: [email protected] 
[1:27:27] aimlessdemon: VIAVOICE 
[1:27:28] AnodyneVS: dog sounds like a seal 
[1:27:30] subscriber kakabookake: lmao 
[1:27:31] vip GodliestCat64: TREKW
[1:27:32] premium sougoe: totally not a trojan site 
[1:27:32] subscriber snosa: boop 
[1:27:33] sub-gift-leader divind95: lol 
[1:27:33] broadcaster turbo GreatSphynx: jank spank 
[1:27:34] vip artist-badge Guardison: odoLUL
[1:27:37] premium huchine_: ventrillo 
[1:27:37] grandfatigue: LUL
[1:27:37] Origfx: those fucking names 
[1:27:38] subscriber partner Temiree: well that was easy 
[1:27:38] subscriber sub-gifter maxzlock: jake whhat 
[1:27:40] vip premium plorf: spanker 
[1:27:40] sub-gift-leader divind95: S E N D 
[1:27:41] moderator game-developer DaveKap: wow that's a slow fuckin internet 
[1:27:41] hexam_project: lol jank spank 
[1:27:41] twitch-recap-2023 dringoose: Santa@ santaclauseisreal.com 
[1:27:43] SushiGummy: santa's gonna be sweating when he gets this email 
[1:27:44] BLCeee: THE FUTURE 
[1:27:45] subscriber snosa: odoPulp
[1:27:46] subscriber twitch-recap-2023 Piyokopyo: that's gonna go right in the spam folder 
[1:27:46] subscriber premium Kythuulu: this will be beamed directly into santas skull 
[1:27:48] subscriber AgentAtaraxia: VEERUS 
[1:27:48] vip premium plorf: zzooTrip
[1:27:51] Origfx: this has big leisure suite larry vibes 
[1:27:51] subscriber snosa: e'mail 
[1:27:52] twitch-recap-2023 WheresColonelPopcorn: oh schpankenmeharder! 
[1:27:53] premium huchine_: he got on vent to hit up santa 
[1:27:54] subscriber sub-gifter maxzlock: ahhh the internet 
[1:27:58] macil_tech: santa is even more of a boomer 
[1:28:01] subscriber sub-gifter maxzlock: PROFESSOR WERNSTRUM 
[1:28:06] rplace-2023 netyuui: :go 
[1:28:13] twitch-recap-2023 GigiWuzHere_: D:
[1:28:13] Bladestorm01: cityville 
[1:28:18] SushiGummy: Why was he happy to see that this kid's grandma was missing? 
[1:28:19] BLCeee: D:
[1:28:22] hexam_project: santa in a TRAQ SOOT 
[1:28:22] Origfx: poison 
[1:28:26] vip GodliestCat64: lol 
[1:28:26] Bobbler386: POIRSON 
[1:28:28] testicle_torsion: just a touch 
[1:28:28] sub-gift-leader divind95: just a touch 
[1:28:28] xexsxexs: drip 
[1:28:29] subscriber premium Kythuulu: LUL
[1:28:32] subscriber superultracombo-2023 D_tector008: santa is a slv 
[1:28:33] Creatures_Features: .. a tought lol 
[1:28:34] subscriber superultracombo-2023 D_tector008: slav 
[1:28:41] twitch-recap-2023 GigiWuzHere_: You committed a hit a run last year Santa 
[1:28:44] Origfx: BERMAN
[1:28:46] twitch-recap-2023 GigiWuzHere_: And 
[1:28:46] vip artist-badge Guardison: Grandma X 
[1:28:47] subscriber BingsF: jake@internet 
[1:28:47] subscriber solberserker: Why does Santa sound like hes a Jewish Brooklynite 
[1:28:48] subscriber snosa: ??? 
[1:28:49] subscriber JoGoBeans: :)
[1:28:49] BLCeee: GRANDMA X 
[1:28:50] superultracombo-2023 rattletrap69: ,':J 
[1:28:53] subscriber twitch-recap-2023 Piyokopyo: so he ran her over and stole her 
[1:28:54] superultracombo-2023 Mattmatatt: the grandma holding chamber 
[1:28:54] subscriber partner Temiree: she's been in bed for ten months? 
[1:28:58] premium DinnerCalzone: shpankenheimer 
[1:28:59] mick_sq: HolidaySanta oh hoe hoe odoAWOOGA
[1:28:59] subscriber twitch-recap-2023 Piyokopyo: instead of going to a hospital 
[1:29:03] twitch-recap-2023 GigiWuzHere_: Wow so he just kidnapped her?? 
[1:29:05] Bladestorm01: It's like METROPOLIS TOWN 
[1:29:06] broadcaster turbo GreatSphynx: cant believe santa drugged her after the hit n run 
[1:29:11] subscriber premium Kythuulu: who are those other guys 
[1:29:11] sub-gift-leader divind95: immeejitly 
[1:29:15] SushiGummy: Santa, how often do you do this? 
[1:29:15] superultracombo-2023 rattletrap69: imMEJITLY 
[1:29:16] subscriber twitch-recap-2023 n0tthedoctor: Kidnapped Grandma for a year greats8ZooTrip
[1:29:21] premium sougoe: Bro why are there 2 other people 
[1:29:22] vip artist-badge Guardison: ALERTA B & E ALERTA
[1:29:23] subscriber twitch-recap-2023 n0tthedoctor: greats8Bruh
[1:29:25] machine_head: this guy looks like a falmer 
[1:29:28] TacoTittyTatas: dump this old lady off and have them deal with it 
[1:29:29] twitch-recap-2023 GigiWuzHere_: OhMyDog
[1:29:33] vip GodliestCat64: FREEZEYOUREADEADMAN 
[1:29:35] subscriber twitch-recap-2023 Piyokopyo: sweatFrog
[1:29:35] macil_tech: the grinch 
[1:29:39] subscriber snosa: hi
[1:29:39] twitch-recap-2023 WolfzenSkiigh: Knows where EVERYONE in the world lives but had no idea who this lady was 
[1:29:42] twitch-recap-2023 Annonn140: monkaS
[1:29:42] Origfx: HUHH
[1:29:44] superultracombo-2023 sofamire: Tingle 
[1:29:44] twitch-recap-2023 GigiWuzHere_: monkaS shoot it 
[1:29:46] machine_head: get out of my fucking house 
[1:29:47] Duckiestrides: the cipsneed 
[1:29:49] Origfx: bottom elf noise 
[1:29:52] bits nyeaszel: STRANGER DANGER 
[1:29:53] superultracombo-2023 Mattmatatt: this is a famous VA right? 
[1:29:55] broadcaster turbo GreatSphynx: wideHUH
[1:29:56] sub-gift-leader divind95: Stare
[1:29:59] vip artist-badge Guardison: ET moment 
[1:30:00] grandfatigue: tendiAAH
[1:30:00] subscriber premium Kythuulu: ??? 
[1:30:01] twitch-recap-2023 GigiWuzHere_: wideHUH
[1:30:02] sub-gift-leader divind95: Tf was that 
[1:30:02] premium DinnerCalzone: HYAAAAGH 
[1:30:02] SushiGummy: ??? 
[1:30:03] subscriber snosa: tendiAAH
[1:30:03] subscriber twitch-recap-2023 Piyokopyo: e.t. greats8OTrip
[1:30:03] glitchcon2020 Lyzerus: ET phone Santa. 
[1:30:04] Creatures_Features: wtf happened 
[1:30:05] subscriber superultracombo-2023 D_tector008: ?? 
[1:30:07] twitch-recap-2023 WheresColonelPopcorn: ouch 
[1:30:07] twitch-recap-2023 WolfzenSkiigh: lmfao 
[1:30:08] subscriber JoGoBeans: that's the first question he asks 
[1:30:10] subscriber partner Temiree: get out of my house Dobbie 
[1:30:10] twitch-recap-2023 GigiWuzHere_: WHAT
[1:30:10] vip artist-badge Guardison: CRIME SCENE 2 
[1:30:11] subscriber sofasofia: gramma pls 
[1:30:12] xexsxexs: extortion 
[1:30:15] macil_tech: santa sent an assassin 
[1:30:18] subscriber snosa: bye :)
[1:30:19] Origfx: sweatFrog stranger danger 
[1:30:20] vip Snudl: HUHH
[1:30:21] AnodyneVS: why would he just take her as if she was lost, bro you hit her in front of her house 
[1:30:21] bits nyeaszel: ok bye :)
[1:30:22] Duckiestrides: ET REFERENCE ???? 
[1:30:22] twitch-recap-2023 Annonn140: LUL
[1:30:23] subscriber twitch-recap-2023 Piyokopyo: i love grandpa 
[1:30:23] vip premium plorf: lol 
[1:30:24] subscriber JoGoBeans: catPls
[1:30:24] vip GodliestCat64: Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5
[1:30:25] twitch-recap-2023 GigiWuzHere_: Omg 
[1:30:27] subscriber premium Kythuulu: catPls
[1:30:27] vip subscriber twitch-recap-2023 Whats_Aleppo: limesNani
[1:30:28] vip artist-badge Guardison: papaPlz k bye 
[1:30:28] SushiGummy: they kinda just ignored that electric touch thing 
[1:30:29] vip Babbott_Orion: based grandpa 
[1:30:30] twitch-recap-2023 Merak_r: Based grandpa 
[1:30:32] subscriber twitch-recap-2023 Piyokopyo: his mind is completely shot 
[1:30:32] subscriber snosa: VIBE
[1:30:34] Takamatsu2: senile 
[1:30:35] rplace-2023 netyuui: Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5
[1:30:36] sub-gift-leader divind95: VIBE
[1:30:40] Boscodbear: the grandpa made the right decision signing away his power of attorney 
[1:30:42] subscriber snosa: odoNo
[1:30:43] xexsxexs: !corn 
[1:30:44] moderator partner Nightbot: Corn
[1:30:44] vip subscriber twitch-recap-2023 Whats_Aleppo: VIBE
[1:30:45] SushiGummy: odoNo
[1:30:51] rplace-2023 netyuui: Funnywhitecat5 funnywhitecat5 Funnywhitecat5 funnywhitecat5
[1:30:53] subscriber sofasofia: videochessLowlyWorm
[1:30:54] vip artist-badge Guardison: odoPain
[1:30:55] vip GodliestCat64: Funnywhitecat5 It will feel like christmas Funnywhitecat5
[1:30:56] subscriber malty_meatia: Corn
[1:30:59] subscriber twitch-recap-2023 Piyokopyo: he really did he has no control of his faculties lol 
[1:31:02] twitch-recap-2023 GigiWuzHere_: This isn't in the song 
[1:31:05] subscriber partner Temiree: greats8YoTrip
[1:31:05] itsjuicefruit: horoboKiwi
[1:31:06] machine_head: :D
[1:31:07] xexsxexs: he is high on mdma 
[1:31:14] xexsxexs: rolling 
[1:31:17] sub-gift-leader divind95: this song's a banger ngl 
[1:31:19] vip twitch-recap-2023 squirrelcabinet: wideVIBE
[1:31:32] subscriber DerkieInTheDarkie: why did they score this exciting visiting the north pole montage with a sad slow song instead of like. something exciting 
[1:31:41] sub-gift-leader divind95: gotta be comfy 
[1:31:42] bits nyeaszel: hyooman 
[1:31:43] vip GodliestCat64: A HU MON quarkHype
[1:31:48] SushiGummy: Now we're gonna have to silence him 
[1:31:51] bits nyeaszel: ADHD moment 
[1:31:52] Origfx: literally every kid 
[1:31:52] subscriber twitch-recap-2023 Piyokopyo: The jake spankenheimer 
[1:31:52] macil_tech: santa doesn't like it when his slaves are seen by others 
[1:31:55] twitch-recap-2023 GigiWuzHere_: Crosher
[1:32:01] Bladestorm01: BTW the dad is VOICE by the guy who does Piccolo LUL
[1:32:08] subscriber superultracombo-2023 D_tector008: wat 
[1:32:09] bits nyeaszel: :)
[1:32:09] Blocknight1: :)
[1:32:13] subscriber twitch-recap-2023 Piyokopyo: greats8Bruh
[1:32:13] sub-gift-leader divind95: Sabat?! 
[1:32:17] Origfx: WHO? 
[1:32:19] subscriber twitch-recap-2023 n0tthedoctor: greats8Bruh
[1:32:24] bits nyeaszel: D:
[1:32:25] subscriber sofasofia: D:
[1:32:31] vip subscriber twitch-recap-2023 Whats_Aleppo: jmikeSadbungle
[1:32:31] subscriber partner Temiree: greats8OdoNo
[1:32:34] Origfx: TREKW get fucked jake 
[1:32:35] vip twitch-recap-2023 squirrelcabinet: DIESOFCRINGE
[1:32:42] vip twitch-recap-2023 viahate: WH rubrOMEGALUL
[1:32:47] twitch-recap-2023 GigiWuzHere_: worfLUL
[1:32:48] Origfx: she kinda sounds like kitboga 
[1:32:49] hexam_project: did they take her off the "sauce" 
[1:32:51] testicle_torsion: yknow AWOOGA 
[1:33:02] premium Zanclodon: she has been in bed for a full 9 months? she will never walk again 
[1:33:03] vip premium artemis_dragmire: sell it to mr fucks 
[1:33:05] twitch-recap-2023 GigiWuzHere_: Did her voice actor change wideHUH
[1:33:09] twitch-recap-2023 Annonn140: WH OMEGALUL 
[1:33:17] twitch-recap-2023 GigiWuzHere_: Chipmunk.. 
[1:33:18] bits nyeaszel: this film is a treatise on gentrification 
[1:33:20] premium StoneCorbel: Oh no she has Transient Global Amnesia 
[1:33:20] macil_tech: he needs to realize both his grandparents are incompetent now. it's for the best that the store is sold 
[1:33:23] hexam_project: that's my question, if she's an alcoholic you can't just take it away 
[1:33:23] vip twitch-recap-2023 squirrelcabinet: catPls
[1:33:26] Takamatsu2: she lost her voice actor in the accident too 
[1:33:33] sub-gift-leader divind95: I just realized Santa's balding with this design 
[1:33:34] subscriber solberserker: Grandma just has demetia 
[1:33:46] subscriber twitch-recap-2023 Piyokopyo: greats8ZooTrip
[1:33:49] sub-gift-leader divind95: No that's grandpa 
[1:33:49] subscriber snosa: zzooTrip
[1:33:54] Origfx: HUHH
[1:33:54] superultracombo-2023 rattletrap69: she JUST now figures that was Santa 
[1:33:55] bits nyeaszel: blargh 
[1:33:56] vip twitch-recap-2023 squirrelcabinet: 🤮 
[1:33:57] subscriber solberserker: VOMIT NOW 
[1:33:58] subscriber premium Kythuulu: I did not like that sound effect 
[1:33:58] superultracombo-2023 rattletrap69: took her a solid 5 seconds 
[1:33:58] subscriber DerkieInTheDarkie: ew 
[1:34:16] subscriber superultracombo-2023 D_tector008: @TheTragicomical theyre lesbians 
[1:34:17] twitch-recap-2023 GigiWuzHere_: Santa took her away long enough for the hoof prints on her forehead and incriminating claw marks went away 
[1:34:19] twitch-recap-2023 Annonn140: EZ
[1:34:26] vip Snudl: quarkYea
[1:34:34] vip twitch-recap-2023 squirrelcabinet: sweatFrogM
[1:34:34] ayypoolboy: Just kill her 
[1:34:40] subscriber JoGoBeans: it should not be that hot in september 
[1:34:40] twitch-recap-2023 GigiWuzHere_: D:
[1:34:41] Origfx: HUHH
[1:34:42] vip GodliestCat64: She reached over with her long ass arm 
[1:34:43] SushiGummy: I've got an idea, just take away the main source of our problems 
[1:34:46] bits nyeaszel: monkaS
[1:34:48] hexam_project: plus santa may currently be wanted by the hague for violating the black friday accords 
[1:34:51] subscriber sofasofia: shpankenhimer 
[1:34:52] superultracombo-2023 rattletrap69: HUH 
[1:34:52] Bubsla: Eugh 
[1:35:01] twitch-recap-2023 wallacewellactually: ant acid? 
[1:35:01] Origfx: this is demented 
[1:35:04] twitch-recap-2023 Annonn140: HUHH
[1:35:13] twitch-recap-2023 meerkapy: hold on Snake, I've got to go swat down some bothersome reindeer 
[1:35:18] sub-gift-leader divind95: mall santa 
[1:35:33] twitch-recap-2023 GigiWuzHere_: santaPls 
[1:35:33] subscriber twitch-recap-2023 Piyokopyo: Uhhh
[1:35:35] Origfx: catBlink alright grandpa, back to bed... 
[1:35:36] vip twitch-recap-2023 squirrelcabinet: buhCat
[1:35:49] broadcaster turbo GreatSphynx: OTrip
[1:35:54] bits nyeaszel: OTrip
[1:35:55] twitch-recap-2023 wallacewellactually: doxed his ass LUL
[1:35:55] twitch-recap-2023 GigiWuzHere_: OYOTrip
[1:35:58] Origfx: sanja? 
[1:35:59] bits nyeaszel: i watch u while u sleep 
[1:36:02] Bladestorm01: Jimmy neutron 
[1:36:04] macil_tech: amazing. Let me hire you 
[1:36:04] subscriber BingsF: ??? 
[1:36:10] subscriber overwatch-league-insider_1 Howoriginal: WA-HEY 
[1:36:12] vip GodliestCat64: WAAHAA 
[1:36:14] BLCeee: WAHHAA 
[1:36:15] subscriber overwatch-league-insider_1 Howoriginal: Frick 
[1:36:15] subscriber twitch-recap-2023 Piyokopyo: he knocked back a couple forties 
[1:36:15] subscriber sofasofia: WAHA 
[1:36:16] superultracombo-2023 rattletrap69: He's meeting a literal god: AMAZING! 
[1:36:16] sub-gift-leader divind95: wallahi 
[1:36:16] SharkFiesty: wow i accept this authority in my life 
[1:36:16] glitchcon2020 Lyzerus: vineGreed
[1:36:18] subscriber snosa: WAAAHAAA 
[1:36:19] vip twitch-recap-2023 squirrelcabinet: D:
[1:36:26] SushiGummy: NOOOO
[1:36:26] subscriber snosa: catBoom
[1:36:28] vip subscriber twitch-recap-2023 Whats_Aleppo: hacker42Dead
[1:36:31] bits nyeaszel: D:
[1:36:36] subscriber snosa: lol 
[1:36:40] SushiGummy: Quincy, stash the body! 
[1:36:41] subscriber twitch-recap-2023 Piyokopyo: how about a HOSPITAL 
[1:36:50] sub-gift-leader divind95: Moving to the North pole immediately 
[1:36:52] subscriber sofasofia: north pole therapy 
[1:36:52] Takamatsu2: her house was right there 
[1:36:55] subscriber snosa: free healthcare... 
[1:36:56] superultracombo-2023 sofamire: KIDNAPPING 
[1:36:57] twitch-recap-2023 wallacewellactually: Damn i wish i had north pole healthcare 
[1:36:57] Origfx: :)
[1:36:58] twitch-recap-2023 GigiWuzHere_: But she didn't get help 
[1:36:59] Creatures_Features: where Rudolf BERMAD
[1:37:00] subscriber malty_meatia: Socialist utopia :3 
[1:37:06] superultracombo-2023 Mattmatatt: why is this terrible billionaire so reasonable? 
[1:37:06] subscriber snosa: :3 
[1:37:09] twitch-recap-2023 Annonn140: he took her to finland WHAT
[1:37:10] bits nyeaszel: sweatFrog
[1:37:11] vip twitch-recap-2023 squirrelcabinet: buhCat
[1:37:12] subscriber partner Temiree: temireEgg
[1:37:15] subscriber snosa: wtf 
[1:37:17] subscriber sofasofia: :3 missing? oops 
[1:37:18] vip twitch-recap-2023 squirrelcabinet: D:
[1:37:20] vip twitch-recap-2023 squirrelcabinet: NOOOO
[1:37:20] vip subscriber twitch-recap-2023 Whats_Aleppo: limesO
[1:37:21] subscriber twitch-recap-2023 Piyokopyo: NOOOO
[1:37:21] sub-gift-leader divind95: this billionaire actually isn't terrible. It's the awooga 
[1:37:21] subscriber robotsnake: Missing again? atpCap
[1:37:23] vip GodliestCat64: NOOOO
[1:37:24] subscriber snosa: NOOOO
[1:37:25] subscriber BingsF: lock him up! 
[1:37:26] vip subscriber twitch-recap-2023 Whats_Aleppo: hacker42NOOO
[1:37:27] hexam_project: NOOOO DO NOT WANT 
[1:37:27] subscriber premium Kythuulu: NOOOO
[1:37:30] twitch-recap-2023 GigiWuzHere_: As he should be tbh 
[1:37:33] superultracombo-2023 rattletrap69: NOOOO
[1:37:34] Bubsla: F her 
[1:37:34] bits nyeaszel: odoPain
[1:37:36] Blocknight1: NOOOO
[1:37:37] subscriber sofasofia: ouuug 
[1:37:38] superultracombo-2023 ultvir: big red lawsuit 
[1:37:38] macil_tech: death penalty 
[1:37:40] subscriber malty_meatia: Dead 
[1:37:43] Origfx: is there only one grandma in this town 
[1:37:45] twitch-recap-2023 wallacewellactually: i mean he did commit a hit and run technically 
[1:37:46] kephyll: uh oh
[1:37:48] subscriber snosa: ms. slime 
[1:37:48] subscriber JoGoBeans: it's coming 
[1:37:48] BLCeee: yo whys is mrs claus so bad 
[1:37:50] subscriber justzac02: cousin mel is fucking hot dont @ me 
[1:37:55] Lyprocaz: greatest song incoming 
[1:37:55] subscriber premium Kythuulu: I am Slime 
[1:37:55] kephyll: its coming 
[1:38:00] sub-gift-leader divind95: why are you saying this in front of her 
[1:38:01] subscriber sofasofia: its coming.... 
[1:38:03] twitch-recap-2023 GigiWuzHere_: Her hair is 💩 shaped 
[1:38:04] subscriber snosa: OYTrip
[1:38:05] vip subscriber twitch-recap-2023 Whats_Aleppo: chat behave 
[1:38:06] superultracombo-2023 bungerlove: Looking
[1:38:08] testicle_torsion: god I wish Cousin mel would kidnap me 
[1:38:09] testicle_torsion: sorry 
[1:38:09] twitch-recap-2023 wallacewellactually: here comes the best part 
[1:38:12] superultracombo-2023 rattletrap69: you are talking RIGHT IN FRONT OF GRANDMA 
[1:38:13] sub-gift-leader divind95: here it comes 
[1:38:14] superultracombo-2023 rattletrap69: WTF 
[1:38:15] bits nyeaszel: HOLY SHIT 
[1:38:18] subscriber JoGoBeans: catPls GRANDMA'S GONNA SUE THE SHIT OUT, OF, SAN-TA catPls
[1:38:18] machine_head: @Whats_Aleppo good luck with that in the upcoming song 
[1:38:19] subscriber bits unspelld: here we gooooo 
[1:38:28] twitch-recap-2023 WolfzenSkiigh: woof 
[1:38:29] vip premium artemis_dragmire: Grandma straight up having dementia as a plot point is fucking wild 
[1:38:30] vip subscriber twitch-recap-2023 Whats_Aleppo: @machine_head limesGiggle
[1:38:34] Creatures_Features: .... so he real enough to sue now?? 
[1:38:35] vip Babbott_Orion: wuff 
[1:38:35] deworming_in_progress: only 2.5 billion people WHAT
[1:38:36] subscriber overwatch-league-insider_1 Howoriginal: Woof 
[1:38:37] bits nyeaszel: wuff 
[1:38:37] BLCeee: woof 
[1:38:37] subscriber snosa: woof 
[1:38:38] Origfx: OTrip
[1:38:40] glitchcon2020 Lyzerus: AWOOGA BERMUS
[1:38:40] broadcaster turbo GreatSphynx: wideHUH
[1:38:40] subscriber snosa: catPls
[1:38:40] vip GodliestCat64: catPls
[1:38:40] vip twitch-recap-2023 squirrelcabinet: catPls
[1:38:41] vip artist-badge Guardison: ALLAMARAINE
[1:38:41] bits nyeaszel: jarJAM
[1:38:42] subscriber twitch-recap-2023 Piyokopyo: jarJAM
[1:38:43] subscriber sofasofia: woof catPls
[1:38:43] subscriber superultracombo-2023 D_tector008: @TheTragicomical this has done irreparable damage to my people 
[1:38:43] subscriber partner Temiree: catPls
[1:38:43] sub-gift-leader divind95: catPls
[1:38:44] subscriber premium Kythuulu: catPls
[1:38:45] aimlessdemon: LUL
[1:38:45] Blocknight1: catPls
[1:38:45] vip subscriber twitch-recap-2023 Whats_Aleppo: vineKermiepls vineKermiepls
[1:38:45] subscriber JoGoBeans: catPls
[1:38:45] superultracombo-2023 Mattmatatt: lmao 
[1:38:45] twitch-recap-2023 Fireborn: WTFF
[1:38:46] vip artist-badge Guardison: catPls
[1:38:46] Dust1210: jarJAM
[1:38:46] vip twitch-recap-2023 squirrelcabinet: limesLook
[1:38:47] premium nickynack: odoAWOOGA
[1:38:49] twitch-recap-2023 GigiWuzHere_: wideHUH
[1:38:49] kephyll: catPls
[1:38:49] premium StoneCorbel: vxaWiggly
[1:38:49] vip GodliestCat64: catPls That's what grandpa's gonna do catPls
[1:38:49] superultracombo-2023 sofamire: love this song 
[1:38:49] vip Babbott_Orion: There's the fucked up leg thing 
[1:38:50] hillbillyinablimp: catPls catPls catPls catPls catPls catPls
[1:38:50] subscriber premium neffpls: catPls 󠀀 
[1:38:50] subscriber twitch-recap-2023 ocarina_boy: catPls
[1:38:51] subscriber sofasofia: greats8Bounce greats8Bounce greats8Bounce
[1:38:51] Origfx: BERMUS
[1:38:51] vip premium plorf: BERMAN
[1:38:51] superultracombo-2023 Mattmatatt: this shit is so dumb 
[1:38:51] subscriber twitch-recap-2023 Piyokopyo: odoAWOOGA
[1:38:51] BLCeee: catPls
[1:38:51] subscriber snosa: WOOHOO!!!!!! 
[1:38:53] subscriber robotsnake: sarueiDance sarueiCheer sarueiDance
[1:38:53] subscriber premium KamiGousama: here it fucking is 
[1:38:53] premium cosmonaughtbob: ALLAMARAINE
[1:38:53] SoCosion: catPls
[1:38:54] Takamatsu2: LUL
[1:38:56] superultracombo-2023 rattletrap69: BERMUS
[1:38:58] rplace-2023 netyuui: catPls
[1:38:58] twitch-recap-2023 wallacewellactually: catJamrgb catJamrgb catJamrgb
[1:38:58] twitch-recap-2023 Annonn140: BERMUS but also HUHH
[1:39:00] vip subscriber twitch-recap-2023 Whats_Aleppo: hacker42Dance hacker42Dance
[1:39:01] BLCeee: ON HIS SIDE 
[1:39:01] twitch-recap-2023 GigiWuzHere_: Racist 
[1:39:03] subscriber JoGoBeans: Watch their legs btw chat 
[1:39:04] vip twitch-recap-2023 viahate: boonAugh
[1:39:05] Lyvash: catPls
[1:39:06] subscriber twitch-recap-2023 Piyokopyo: GettingJiggyWithIt GettingJiggyWithIt GettingJiggyWithIt GettingJiggyWithIt GettingJiggyWithIt GettingJiggyWithIt GettingJiggyWithIt GettingJiggyWithIt
[1:39:07] subscriber malty_meatia: catPls NESSIE catpls NESSIE catPls NESSIE
[1:39:08] sloth4k: sennykSeal
[1:39:10] twitch-recap-2023 GigiWuzHere_: Cancelled D; 
[1:39:10] mick_sq: NESSIE
[1:39:12] Origfx: odoAWOOGA good song 
[1:39:14] subscriber twitch-recap-2023 n0tthedoctor: greats8OTrip greats8Bermus greats8Bruh
[1:39:15] twitch-recap-2023 wallacewellactually: @JoGo_ the ol leg shuffle 
[1:39:16] SauciSufi: gongo timee 
[1:39:16] sub-gift-leader divind95: A LA 
[1:39:20] vip Snudl: catPls Grandpa's gonna sue the pants off of Santa catPls
[1:39:20] subscriber JoGoBeans: the animators screwed up their loegs 
[1:39:22] twitch-recap-2023 GigiWuzHere_: NESSIE
[1:39:23] subscriber sofasofia: NO PANTALONES 
[1:39:23] bits nyeaszel: no pantalones 
[1:39:26] SushiGummy: kermiePls
[1:39:26] moderator game-developer DaveKap: it just keeps going 
[1:39:30] vip twitch-recap-2023 squirrelcabinet: catPls
[1:39:31] xx_noobslaya_xx: no pantalones 
[1:39:32] vip Babbott_Orion: h e l p 
[1:39:39] kephyll: the fuckin background vocals 
[1:39:40] superultracombo-2023 rattletrap69: BERMUS 󠀀 
[1:39:40] twitch-recap-2023 GigiWuzHere_: Ok stop 
[1:39:41] vip Babbott_Orion: vaminos 
[1:39:41] vip artist-badge Guardison: okay pack it up 
[1:39:41] Lyvash: ok we get it 
[1:39:41] subscriber robotsnake: lmao 
[1:39:42] superultracombo-2023 Mattmatatt: vahmahnos 
[1:39:42] Artacus: tits 
[1:39:45] subscriber sofasofia: vamonoush 
[1:39:47] subscriber solberserker: J6 
[1:39:48] bits nyeaszel: odoLUL
[1:39:49] subscriber sub-gifter maxzlock: this movie is a tirp 
[1:39:50] subscriber partner Temiree: Ho Ho Hoax LUL
[1:39:50] subscriber twitch-recap-2023 Piyokopyo: whoever is singing the background vocals needs to blow their nose 
[1:39:52] subscriber AgentAtaraxia: ok ok WRAP IT UP 
[1:39:52] subscriber solberserker: It's J6 but Christmas 
[1:39:56] Duckiestrides: vamahnohs 
[1:39:59] BLCeee: FREE SANTA 
[1:40:02] sub-gift-leader divind95: coal for the DA lmao 
[1:40:03] superultracombo-2023 rattletrap69: coal for the DEA 
[1:40:06] vip subscriber twitch-recap-2023 Whats_Aleppo: lmfao the coal one 
[1:40:08] twitch-recap-2023 wallacewellactually: "lets dec city hall" IS THAT A THREAT 
[1:40:09] bits nyeaszel: LANDMARK CASE 
[1:40:14] Lyvash: Is her first name Gradnma 
[1:40:15] subscriber JoGoBeans: I remember doing Jury Duty wideHUH
[1:40:20] subscriber BingsF: wow TERRIBLE closing statment 
[1:40:22] twitch-recap-2023 wallacewellactually: jury duty sucks ass 
[1:40:22] vip artist-badge Guardison: nice OJ reference 
[1:40:22] vip twitch-recap-2023 squirrelcabinet: limesYou
[1:40:23] subscriber partner Temiree: hyenaStare
[1:40:25] Blocknight1: oh ok 
[1:40:25] subscriber solberserker: HUHAHFHBHDF 
[1:40:27] vip premium plorf: OJ TREKW
[1:40:28] twitch-recap-2023 GigiWuzHere_: WHAT
[1:40:31] SushiGummy: They should get the OJ lawyer to help out Santa, I hear he's pretty good 
[1:40:31] subscriber premium Kythuulu: ok 
[1:40:33] Origfx: thx grandpa 
[1:40:34] subscriber malty_meatia: Ganma Pankeheimuh 
[1:40:43] Lyvash: me 
[1:40:44] Bubsla: ☝️ 
[1:40:48] subscriber twitch-recap-2023 Piyokopyo: MEEKA
[1:40:48] bits nyeaszel: thePeeper
[1:40:50] superultracombo-2023 pjgrich: nah she a bitch 
[1:40:52] BLCeee: SNIFFA 
[1:40:56] mick_sq: sus backpack 
[1:40:57] Blocknight1: MEEKA
[1:40:57] vip twitch-recap-2023 squirrelcabinet: spynXsus
[1:41:03] vip Snudl: It took them months to figure that out 
[1:41:04] subscriber snosa: MEEKA
[1:41:04] Spie812: MEEKA
[1:41:06] glitchcon2020 Lyzerus: Sniff 
[1:41:10] twitch-recap-2023 wallacewellactually: i love that the dog's name is doofus 
[1:41:11] vip subscriber twitch-recap-2023 Whats_Aleppo: MEEKA
[1:41:12] rplace-2023 netyuui: MEEKA
[1:41:13] hillbillyinablimp: MEEKA
[1:41:22] bits nyeaszel: holy shit HWNDU season 4 
[1:41:25] subscriber twitch-recap-2023 Piyokopyo: you have to be an asshole to name your dog doofus 
[1:41:28] macil_tech: walter white's hideout 
[1:41:33] vip twitch-recap-2023 squirrelcabinet: D:
[1:41:34] subscriber bits unspelld: i blame this movie for making me think trials can be televised 
[1:41:36] subscriber snosa: D:
[1:41:45] testicle_torsion: @unspelld they can be tho 
[1:41:47] sub-gift-leader divind95: pretty convenient they have a cabin in the middle of nowhere 
[1:41:57] bits nyeaszel: bruleWhere
[1:42:00] subscriber bits unspelld: @testicle_torsion i guess in rare cases but i got so confused 
[1:42:01] subscriber superultracombo-2023 D_tector008: WHOOPS YOU HAVE TO PUT THE CD 
[1:42:02] Boscodbear: BEAR FORCE 
[1:42:06] vip subscriber twitch-recap-2023 Whats_Aleppo: limesO
[1:42:08] subscriber superultracombo-2023 D_tector008: same voice 
[1:42:09] subscriber snosa: go fight the bears 
[1:42:15] superultracombo-2023 rattletrap69: Quincy the GOAT 
[1:42:19] subscriber sofasofia: mel can destroy those bears 
[1:42:20] subscriber malty_meatia: @d_tector008 Lol it is pretty close 
[1:42:22] vip twitch-recap-2023 squirrelcabinet: :O
[1:42:23] testicle_torsion: boonSweat
[1:42:24] subscriber twitch-recap-2023 Piyokopyo: CatDisplease
[1:42:28] BLCeee: email is so powerful 
[1:42:28] subscriber robotsnake: E-Mail 
[1:42:28] Boscodbear: gross 
[1:42:31] twitch-recap-2023 Annonn140: HUHH
[1:42:32] superultracombo-2023 rattletrap69: Mel is gonna sue the pants off those bears 
[1:42:32] Takamatsu2: wtf 
[1:42:34] twitch-recap-2023 wallacewellactually: classic 
[1:42:35] vip subscriber twitch-recap-2023 Whats_Aleppo: HUHH
[1:42:35] Lyvash: What is that gross old man 
[1:42:38] sub-gift-leader divind95: respiratory illness odoLUL
[1:42:53] Bubsla: Spankenhrimer 
[1:42:55] vip twitch-recap-2023 squirrelcabinet: osmoLick
[1:43:21] subscriber snosa: spankenheimer 
[1:43:23] superultracombo-2023 rattletrap69: who up spanken they heimer 
[1:43:32] subscriber twitch-recap-2023 Piyokopyo: odoLUL
[1:43:34] Artacus: stewie griffin 
[1:43:35] twitch-recap-2023 Annonn140: odoPain just a burning memory 
[1:43:37] vip subscriber twitch-recap-2023 Whats_Aleppo: limesGiggle
[1:43:41] subscriber justzac02: drugs 
[1:43:42] Boscodbear: spankenheimer sounds like a joke vinny would come up with 
[1:43:47] vip twitch-recap-2023 squirrelcabinet: Crunch
[1:43:47] superultracombo-2023 pjgrich: ok but why are they stopping her I would sue the shit outta santa too 
[1:43:48] subscriber snosa: she spank on my hei til i mer 
[1:43:48] sub-gift-leader divind95: actual poison 
[1:43:55] bits nyeaszel: carlPog
[1:43:58] vip artist-badge Guardison: OYOTrip
[1:44:00] vip twitch-recap-2023 squirrelcabinet: she member OYOTrip
[1:44:00] subscriber partner Temiree: prawnzPOG
[1:44:02] Duckiestrides: @Boscodbear fr 
[1:44:02] twitch-recap-2023 wallacewellactually: its always fruitcake 
[1:44:04] twitch-recap-2023 wallacewellactually: OH YEAHHH 
[1:44:04] BLCeee: OH YAH 
[1:44:04] subscriber JoGoBeans: OH YEAH 
[1:44:05] subscriber malty_meatia: Memorycake 
[1:44:05] subscriber snosa: oh yeah 
[1:44:05] vip premium artemis_dragmire: She's lucid! 
[1:44:06] subscriber premium Kythuulu: oh YEAH 
[1:44:06] sloth4k: lsd in the cake 
[1:44:06] vip subscriber twitch-recap-2023 Whats_Aleppo: limesWow
[1:44:07] vip artist-badge Guardison: OYOTrip BRAIN WORK 
[1:44:07] superultracombo-2023 rattletrap69: LMAOOOOOOO 
[1:44:09] Bubsla: Oh Yeah 
[1:44:10] CarrotCube: jmikeRember
[1:44:11] subscriber sofasofia: OH YEAH 
[1:44:12] Lyvash: she memberies 
[1:44:13] xhiggy: OH YEAH 
[1:44:17] mick_sq: It's a Christmas miracle! 
[1:44:21] bits nyeaszel: LuL
[1:44:21] twitch-recap-2023 GigiWuzHere_: 💩 hair 
[1:44:25] vip twitch-recap-2023 Korokun: More references 
[1:44:29] BLCeee: yo the reprise 
[1:44:38] subscriber twitch-recap-2023 Piyokopyo: CatDisplease verdict in one day? 
[1:44:41] vip subscriber bits-charity peachteadreams: catPls cursed movie 
[1:44:41] bits nyeaszel: lesbians 
[1:44:46] twitch-recap-2023 Annonn140: WHAT
[1:44:50] SushiGummy: he did hit her though 
[1:44:50] vip artist-badge Guardison: IMPOSTER 
[1:44:51] superultracombo-2023 rattletrap69: what 
[1:44:52] vip twitch-recap-2023 squirrelcabinet: WHAT
[1:44:53] superultracombo-2023 rattletrap69: WHAT
[1:44:54] BLCeee: its so melover 
[1:44:56] bits nyeaszel: WHAT
[1:44:56] subscriber snosa: tendiAAH
[1:44:57] vip subscriber twitch-recap-2023 Whats_Aleppo: limesO
[1:44:57] McFlyMartini: i just realized that Daphne's voice actress sounds a lot like Poison Ivy from Batman the Animated Series 
[1:45:01] vip artist-badge Guardison: ??? 
[1:45:01] vip twitch-recap-2023 squirrelcabinet: vineClap
[1:45:02] broadcaster turbo GreatSphynx: ez 
[1:45:04] superultracombo-2023 pjgrich: Man fuck Grandma Hate her 
[1:45:04] BLCeee: Clap EZ
[1:45:05] mick_sq: She's gonna admit drunkness? 
[1:45:05] Artacus: that's not how that works 
[1:45:05] DumboAKAwumbo: ???? 
[1:45:06] Bubsla: Ex 
[1:45:06] subscriber partner Temiree: temireEgg ??? 
[1:45:06] vip artist-badge Guardison: I mean he was still responsible but 
[1:45:07] subscriber sofasofia: Clap
[1:45:08] vip twitch-recap-2023 Korokun: Is that how it works? 
[1:45:08] saxorlaud2: (armed guards storm the room and taze the intruders, the ruling continues) 
[1:45:10] SushiGummy: but she still disappeared?? 
[1:45:10] twitch-recap-2023 GigiWuzHere_: Ok bruleWhere
[1:45:11] bits nyeaszel: w- what about the hide and 
[1:45:12] Bubsla: Ez 
[1:45:12] superultracombo-2023 pjgrich: Boooo 
[1:45:12] vip twitch-recap-2023 squirrelcabinet: sweatFrogM
[1:45:12] bits nyeaszel: oh
[1:45:14] Boscodbear: they wont question why grandma randomly appeared though 
[1:45:14] Artacus: true 
[1:45:18] hillbillyinablimp: sleighicular 
[1:45:21] Takamatsu2: drugs 
[1:45:40] subscriber JoGoBeans: how will they do that 
[1:45:43] sub-gift-leader divind95: you mean they have to eat year old cake? 
[1:45:49] subscriber snosa: yus 
[1:45:52] subscriber justzac02: why is this kid allowed 
[1:45:54] vip twitch-recap-2023 squirrelcabinet: Crunch
[1:45:56] subscriber malty_meatia: Hey Arnold-ass juror 
[1:45:56] twitch-recap-2023 GigiWuzHere_: odoEw
[1:45:56] superultracombo-2023 sofamire: yush 
[1:45:58] subscriber twitch-recap-2023 Piyokopyo: Tasty
[1:45:58] vip subscriber twitch-recap-2023 Whats_Aleppo: this movie made me think fruit cake was good limesFeels
[1:45:59] vip artist-badge Guardison: veryCat
[1:46:01] twitch-recap-2023 WolfzenSkiigh: Mold Cake 
[1:46:01] vip premium plorf: chewLes
[1:46:02] superultracombo-2023 rattletrap69: Ahhh! 
[1:46:03] superultracombo-2023 rattletrap69: oooo! 
[1:46:06] vip artist-badge Guardison: odoEw
[1:46:06] subscriber premium neffpls: chewLes
[1:46:07] BLCeee: its a year old of course it sucks 
[1:46:07] rplace-2023 netyuui: chewLes
[1:46:09] subscriber twitch-recap-2023 Piyokopyo: odoEw
[1:46:10] bits nyeaszel: odoEw
[1:46:12] subscriber partner Temiree: temireDisgust
[1:46:14] subscriber snosa: odoEw
[1:46:17] subscriber malty_meatia: Stink stank stunk 
[1:46:18] sub-gift-leader divind95: odoEw
[1:46:19] subscriber JoGoBeans: odoEw
[1:46:25] superultracombo-2023 sofamire: reindeer pee 
[1:46:27] Boscodbear: dont ask mike what the ingredient is 
[1:46:28] twitch-recap-2023 WolfzenSkiigh: Bad Stuff(tm) 
[1:46:29] subscriber JoGoBeans: wait so he poisoned them 
[1:46:34] premium Zanclodon: Bill Cosby's fruitcake recipe 
[1:46:35] glhf-pledge Vulkarl: oh my god BAD STUFF 
[1:46:35] mick_sq: Does the one with nuts count as fruitcake, chat? 
[1:46:43] vip artist-badge Guardison: drug addict 
[1:46:43] subscriber partner Temiree: LUL
[1:46:44] bits nyeaszel: SUE THE REINDEER 
[1:46:44] vip subscriber twitch-recap-2023 Whats_Aleppo: limesBlink
[1:46:45] subscriber justzac02: drug addicts 
[1:46:47] Blocknight1: drunk driving 
[1:46:47] superultracombo-2023 bungerlove: Drugs 
[1:46:48] vip Snudl: ADDICT 
[1:46:50] Boscodbear: arent nuts a fruit 
[1:46:54] deworming_in_progress: sue the reindeer it's obviously sentient 
[1:46:54] SushiGummy: did he just feed the jury reindeer drugs?? 
[1:46:58] Lyvash: Good job, his cousin will go to jail instead 
[1:46:59] superultracombo-2023 rattletrap69: arent we all a lil freaky, reindeer 
[1:46:59] subscriber snosa: lol 
[1:47:01] vip twitch-recap-2023 squirrelcabinet: Wowee
[1:47:06] sub-gift-leader divind95: chill judge 
[1:47:08] twitch-recap-2023 GigiWuzHere_: 🦌 
[1:47:08] BLCeee: kangaroo court 
[1:47:11] subscriber snosa: phoenix wright 
[1:47:23] vip artist-badge Guardison: yeah just leave a note 
[1:47:25] Boscodbear: bird law would have thrown this case out weeks ago 
[1:47:25] testicle_torsion: oh a note, all charges dismissed 
[1:47:29] Takamatsu2: they are not goingto arrest the reindeer ? 
[1:47:30] bits nyeaszel: OTrip
[1:47:32] Artacus: why admit it 
[1:47:32] superultracombo-2023 rattletrap69: SHE'S GOING NUTS 
[1:47:34] vip subscriber twitch-recap-2023 Whats_Aleppo: limesO
[1:47:34] moderator founder turbo Dragoneye77: the moral of the story is gingers are evil 
[1:47:38] twitch-recap-2023 GigiWuzHere_: Anddddds 
[1:47:39] BLCeee: EVIL 
[1:47:40] superultracombo-2023 pjgrich: Fuck she goin to jaí 
[1:47:41] superultracombo-2023 sofamire: aaand 
[1:47:41] thedoodler303: D:
[1:47:41] vip twitch-recap-2023 squirrelcabinet: D:
[1:47:42] hexam_project: matlock level trial 
[1:47:42] subscriber snosa: D:
[1:47:43] premium Iceckryss: It's a good thing Mel is a moron and didnt destroy that note 
[1:47:43] bits nyeaszel: D:
[1:47:43] Rooks_Castle: D:
[1:47:44] twitch-recap-2023 GigiWuzHere_: NO AND THEN 
[1:47:44] BLCeee: D:
[1:47:45] Lyvash: D:
[1:47:45] subscriber partner Temiree: D:
[1:47:45] premium goldwolf128: mean 
[1:47:46] saxorlaud2: BASED 
[1:47:46] subscriber sofasofia: D:
[1:47:46] subscriber JoGoBeans: D:
[1:47:46] sub-gift-leader divind95: D:
[1:47:47] mick_sq: D:
[1:47:47] vip artist-badge Guardison: yeah okay just 
[1:47:48] vip Babbott_Orion: Not based 
[1:47:48] subscriber twitch-recap-2023 Piyokopyo: Based
[1:47:49] vip subscriber twitch-recap-2023 Whats_Aleppo: D:
[1:47:50] vip artist-badge Guardison: no one made you reveal that 
[1:47:50] twitch-recap-2023 Annonn140: Based
[1:47:51] bits nyeaszel: Based
[1:47:52] subscriber JoGoBeans: FallHalp
[1:47:54] superultracombo-2023 pjgrich: Based
[1:47:55] subscriber kakabookake: i can fix her 
[1:47:55] testicle_torsion: SHE DOES 
[1:47:58] vip twitch-recap-2023 squirrelcabinet: limesCop
[1:48:00] subscriber BingsF: LUL
[1:48:01] sub-gift-leader divind95: QUEEN 
[1:48:01] Blocknight1: LUL
[1:48:02] superultracombo-2023 rattletrap69: Based
[1:48:02] subscriber sofasofia: lmao 
[1:48:02] thedoodler303: LUL
[1:48:02] hillbillyinablimp: based 
[1:48:03] VRJosh: LUL arrested for almost ruining christmas 
[1:48:03] mick_sq: LUL
[1:48:03] testicle_torsion: I can enrich her 
[1:48:03] subscriber partner Temiree: LUL
[1:48:04] sub-gift-leader divind95: LuL
[1:48:04] subscriber robotsnake: Based
[1:48:04] twitch-recap-2023 Annonn140: LUL
[1:48:04] superultracombo-2023 Mattmatatt: lol 
[1:48:04] subscriber snosa: lol 
[1:48:04] premium goldwolf128: kek 
[1:48:05] vip artist-badge Guardison: oh he's INTO it 
[1:48:05] bits nyeaszel: LuL
[1:48:05] BLCeee: LUL
[1:48:05] subscriber premium Kythuulu: babe 
[1:48:06] subscriber twitch-recap-2023 Piyokopyo: why is the woman from fargo here 
[1:48:06] Dust1210: he's into it 
[1:48:07] SushiGummy: Based
[1:48:07] premium Iceckryss: BASED 
[1:48:08] twitch-recap-2023 wallacewellactually: arrested for crime 
[1:48:08] twitch-recap-2023 WolfzenSkiigh: get fuckeed 
[1:48:08] subscriber twitch-recap-2023 carlysle_: LUL
[1:48:08] subscriber twitch-recap-2023 n0tthedoctor: LUL LUL LUL
[1:48:09] vip twitch-recap-2023 squirrelcabinet: LUL
[1:48:09] vip premium artemis_dragmire: WHY WAS THE COP MINNESOTAN 
[1:48:10] McFlyMartini: the twitch model 
[1:48:11] vip bits Jane_Inferno: LUL
[1:48:11] vip subscriber twitch-recap-2023 Whats_Aleppo: limesGiggle
[1:48:11] subscriber malty_meatia: Yaaaay 
[1:48:13] Boscodbear: dude is visiting every weekend 
[1:48:14] twitch-recap-2023 GigiWuzHere_: I can fix santa 
[1:48:14] hexam_project: everyone knows you have to watch matlock to get your law degree Kappa
[1:48:15] subscriber snosa: babe. ur gonna look so good in jail 
[1:48:16] subscriber malty_meatia: No 
[1:48:16] subscriber sofasofia: videochessRookCheer O YEA 
[1:48:18] superultracombo-2023 pjgrich: Punch them take their gun and shhoot em 
[1:48:19] superultracombo-2023 rattletrap69: NO 
[1:48:19] subscriber twitch-recap-2023 ocarina_boy: greats8YoTrip Clap
[1:48:19] vip GodliestCat64: STUPID 
[1:48:23] bits nyeaszel: OTrip Clap
[1:48:23] thedoodler303: Clap
[1:48:28] BLCeee: Clap HE DID IT 
[1:48:29] vip subscriber twitch-recap-2023 Whats_Aleppo: Clap
[1:48:29] superultracombo-2023 sofamire: Clap
[1:48:29] twitch-recap-2023 Annonn140: FeelsStrongMan Clap
[1:48:31] vip artist-badge Guardison: what's with the santa army 
[1:48:32] saxorlaud2: wait your honor, i also have evidence that we can end world hunger in the next 5 minutes 
[1:48:33] subscriber JoGoBeans: Santa clones OYOTrip
[1:48:33] subscriber snosa: Clap
[1:48:35] Bubsla: YAY 
[1:48:35] Boscodbear: still doesnt excuse the manslaughter case 
[1:48:38] twitch-recap-2023 GigiWuzHere_: wideHUH
[1:48:40] subscriber malty_meatia: Doofus saved Christmas 
[1:48:48] bits nyeaszel: OYOTrip
[1:48:49] vip Babbott_Orion: OYOTrip
[1:48:52] vip artist-badge Guardison: Clap YEAH FRANCHISE 
[1:48:54] twitch-recap-2023 Annonn140: WHAT
[1:48:57] superultracombo-2023 sofamire: HE HAS 4 FINGERS 
[1:48:58] vip GodliestCat64: greats8YoTrip YEAH MORE MONEY 
[1:48:59] bits nyeaszel: INCEST? 
[1:48:59] twitch-recap-2023 wallacewellactually: OYOTrip BILLIONAIRES 
[1:48:59] sub-gift-leader divind95: CAPITALISM WINS 
[1:49:00] vip premium artemis_dragmire: Clap Yay capitalism 
[1:49:01] broadcaster turbo GreatSphynx: this anime sucks 
[1:49:01] superultracombo-2023 rattletrap69: he's IN 
[1:49:01] subscriber twitch-recap-2023 Piyokopyo: greats8YoTrip quality will drastically go down 
[1:49:02] Crunkerton: Today I learned the North Pole has an extradition treaty with America. 
[1:49:02] subscriber BingsF: god i hate jake 
[1:49:03] twitch-recap-2023 GigiWuzHere_: Horrible family 
[1:49:04] BLCeee: CAPITALISM 
[1:49:06] subscriber overwatch-league-insider_1 Howoriginal: Time to create 100 soulless copies of the original :)
[1:49:07] machine_head: WAR 
[1:49:07] vip Babbott_Orion: @GreatSphynx LMAO 
[1:49:07] subscriber JoGoBeans: @nyeaszel wideHUH
[1:49:08] vip artist-badge Guardison: @nyeaszel Uhhh
[1:49:08] subscriber snosa: nuthin 
[1:49:10] Lyvash: Grandma became a Corpo, bad ending 
[1:49:11] superultracombo-2023 pjgrich: Fuck you Jake 
[1:49:17] dresden81: he blew it. he could've had anything. 
[1:49:17] superultracombo-2023 rattletrap69: incest? HE'S IN B)
[1:49:17] Takamatsu2: LUL
[1:49:18] mick_sq: Yay, Cousin Whatever is in jail! 
[1:49:19] thedoodler303: @nyeaszel wideHUH
[1:49:22] bits nyeaszel: monkaS
[1:49:23] subscriber ferrio80: Gradnma looks more like mrs claus than mrs claus 
[1:49:24] subscriber partner Temiree: @GreatSphynx the manga's better 
[1:49:26] subscriber JoGoBeans: @rattletrap69 wideHUH wideHUH wideHUH wideHUH
[1:49:33] vip twitch-recap-2023 squirrelcabinet: NOOOO
[1:49:35] vip artist-badge Guardison: GRANDMA NOOOO
[1:49:37] saxorlaud2: monkaS
[1:49:38] BLCeee: WAH HAAH 
[1:49:38] twitch-recap-2023 wallacewellactually: WAHHH HAHHH 
[1:49:38] vip subscriber twitch-recap-2023 Whats_Aleppo: D:
[1:49:39] subscriber overwatch-league-insider_1 Howoriginal: WAHA 
[1:49:39] thedoodler303: NOOOO
[1:49:39] subscriber snosa: wat 
[1:49:40] subscriber sofasofia: greats8Roiker
[1:49:41] subscriber justzac02: DEATH 
[1:49:41] DumboAKAwumbo: GRANDMA DEAD D:
[1:49:41] bits nyeaszel: monkaS 󠀀 
[1:49:41] subscriber twitch-recap-2023 Piyokopyo: GET A LOAD OF THIS
[1:49:41] Blocknight1: NOOOO
[1:49:42] moderator founder turbo Dragoneye77: SANTA IS A PSYCHO WTF 
[1:49:43] Rooks_Castle: Kill streak 
[1:49:43] SushiGummy: NOOOO
[1:49:44] saxorlaud2: DEAD 
[1:49:44] vip twitch-recap-2023 squirrelcabinet: catPls
[1:49:45] superultracombo-2023 soupesu: HUHHH 
[1:49:46] mick_sq: RUINED 
[1:49:46] moderator game-developer DaveKap: DEAD 
[1:49:46] vip subscriber twitch-recap-2023 Whats_Aleppo: hacker42NOOO
[1:49:46] subscriber malty_meatia: Dead 
[1:49:47] Artacus: fucking dead 
[1:49:47] subscriber premium Kythuulu: NOOOO
[1:49:47] Crunkerton: She's into it 
[1:49:47] vip premium plorf: NOOOO
[1:49:48] deworming_in_progress: dumb ass hoe 
[1:49:48] superultracombo-2023 rattletrap69: DEAD 
[1:49:48] subscriber premium neffpls: ACTUALLY DEAD NOW 
[1:49:49] twitch-recap-2023 GigiWuzHere_: She died 
[1:49:49] bits nyeaszel: odoLUL Clap
[1:49:49] BLCeee: catPls
[1:49:49] subscriber snosa: odoLUL Clap
[1:49:49] twitch-recap-2023 Annonn140: LUL
[1:49:50] vip GodliestCat64: NOOOO
[1:49:50] subscriber twitch-recap-2023 n0tthedoctor: HahaNutcracker
[1:49:52] twitch-recap-2023 WolfzenSkiigh: The Reindeer Pheromones NotLikeThis
[1:49:52] vip GodliestCat64: SHE'S DEAD 
[1:49:53] Bubsla: Rip 
[1:49:54] vip artist-badge Guardison: HE LEFT AGAIN 
[1:49:57] twitch-recap-2023 franceybear: WHAT
[1:49:57] superultracombo-2023 Mattmatatt: this dude's music might be my least favorite music on the planet 
[1:49:58] superultracombo-2023 pjgrich: HAHA FUCK you 
[1:49:58] sub-gift-leader divind95: HIT N RUN 
[1:49:58] Takamatsu2: oh he ran this way LUL
[1:49:58] Bladestorm01: BRIAN LOOK OUT 
[1:49:59] subscriber robotsnake: ??? 
[1:50:00] vip Babbott_Orion: Didn't even come back 
[1:50:01] subscriber twitch-recap-2023 Piyokopyo: he keeps running away 
[1:50:01] vip twitch-recap-2023 squirrelcabinet: Clap
[1:50:02] subscriber sofasofia: feliz navidad Clap
[1:50:03] twitch-recap-2023 wallacewellactually: Grandma now has a permanently broken skull 
[1:50:03] Artacus: he didn't even say sorry 
[1:50:03] premium Iceckryss: GODDAMN IT GRANDMA 
[1:50:04] subscriber partner Temiree: temireClap
[1:50:05] saxorlaud2: ACTUALLY CHARGE HIM 
[1:50:05] vip bits Jane_Inferno: Clap
[1:50:07] subscriber snosa: catPls
[1:50:08] broadcaster turbo GreatSphynx: sue blu 
[1:50:09] vip subscriber twitch-recap-2023 Whats_Aleppo: vineKermiepls
[1:50:09] Lyvash: Santa is a menace 
[1:50:09] subscriber JoGoBeans: catPls
[1:50:09] subscriber overwatch-league-insider_1 Howoriginal: please, don't go! 
[1:50:10] Bobbler386: Clap
[1:50:10] xhiggy: Clap
[1:50:10] twitch-recap-2023 GigiWuzHere_: She should've just died like in the song 
[1:50:11] subscriber malty_meatia: Santa guilty 
[1:50:11] grandfatigue: RobertJam
[1:50:12] superultracombo-2023 rattletrap69: HE CANT KEEP GETTING AWAY WITH THIS
[1:50:13] Boscodbear: amazing how cartoon network was able to make this movie 2 hours and show it back to back 
[1:50:13] broadcaster turbo GreatSphynx: elmo shropshire 
[1:50:14] mick_sq: Glad Grandma Sloppenheimer wash't dead after all. 
[1:50:15] subscriber malty_meatia: Clap
[1:50:17] Solbiaa: catPls
[1:50:21] rplace-2023 netyuui: Clap Feliz Navidad 
[1:50:24] twitch-recap-2023 Annonn140: Clap
[1:50:28] vip artist-badge Guardison: dataSleep
[1:50:29] twitch-recap-2023 wallacewellactually: grandma oppenheim,er 
[1:50:33] subscriber sub-gifter maxzlock: i always avoided this when it played on cartoon network, but ive finally seen it now. What dogshit. Clap
[1:50:37] vip artist-badge Guardison: Joe Suggs 
[1:50:39] broadcaster turbo GreatSphynx: joe suggs 
[1:50:41] vip premium plorf: DIESOFCRINGE
[1:50:42] twitch-recap-2023 Annonn140: actually pretty cool, at least the animation 
[1:50:44] subscriber snosa: joe suggs 
[1:50:44] Bubsla: Wow, people really want Santa to go to jail.. 
[1:50:44] rplace-2023 netyuui: joe suggs 
[1:50:44] subscriber overwatch-league-insider_1 Howoriginal: Grandma Barbenheimer jundSmile
[1:50:48] twitch-recap-2023 GigiWuzHere_: deadass
[1:50:51] subscriber twitch-recap-2023 Piyokopyo: they played this like every fucking christmas 
[1:50:53] subscriber twitch-recap-2023 Piyokopyo: i bet they still do 
[1:50:54] superultracombo-2023 rattletrap69: @maxzlock I liked it until my dad said "wtf is this" ROFLMAO 
[1:50:56] Boscodbear: good thing jerma killed santa 
[1:51:03] Artacus: grandpa was out of it 
[1:51:04] twitch-recap-2023 GigiWuzHere_: Grandpa didn't give a shit 
[1:51:04] superultracombo-2023 pjgrich: yeah 
[1:51:06] subscriber twitch-recap-2023 Piyokopyo: and spooky godmother too 
[1:51:06] subscriber premium Kythuulu: I have seen this countless times and I still could not tell you what happens 
[1:51:09] subscriber twitch-recap-2023 n0tthedoctor: Cartoon Network L 
[1:51:09] superultracombo-2023 rattletrap69: LIKE HE SAID "this is queer" AND I LOL'D 
[1:51:09] premium sougoe: A little too well 
[1:51:16] machine_head: @Annonn140 this is something aired on cartoon network so it definitely is a different weight class than the rest showed here lol 
[1:51:18] subscriber sub-gifter maxzlock: @rattletrap69 lol 
[1:51:20] mick_sq: I think this may be the first thing that I ACTUALLY watched on TV that I've seen on Gongo 
[1:51:27] twitch-recap-2023 GigiWuzHere_: Open 
[1:51:30] vip twitch-recap-2023 squirrelcabinet: catPls
[1:51:31] vip artist-badge Guardison: catPls
[1:51:33] subscriber premium Kythuulu: catPls
[1:51:35] subscriber superultracombo-2023 D_tector008: catPls
[1:51:36] SushiGummy: catPls
[1:51:37] vip Babbott_Orion: catPls
[1:51:37] thedoodler303: @n0tthedoctor Just like that one halloween movie 
[1:51:38] glitchcon2020 DeadheadJackal: Does Grandma know the wages of sin? 
[1:51:38] Lyvash: catPls fuck grandma 
[1:51:39] subscriber snosa: catPls
[1:51:40] twitch-recap-2023 wallacewellactually: ive seen this fuckin special so many times 
[1:51:42] saxorlaud2: catPls
[1:51:45] subscriber malty_meatia: Is Ganma dead this time? 
[1:51:46] Mikroscopic: I like how the original song totally implies that grandma died 
[1:51:48] subscriber sub-gifter maxzlock: grandma got a train ran on by a reindeer 
[1:51:50] superultracombo-2023 rattletrap69: @DeadheadJackal KEK 
[1:51:51] testicle_torsion: poll: open her presents or send them back 
[1:51:54] sub-gift-leader divind95: 2nd verse 
[1:51:55] vip Babbott_Orion: catPls Grandma Caused this 
[1:51:55] vip artist-badge Guardison: aaahhh 
[1:51:56] BLCeee: aahhh 
[1:51:56] subscriber snosa: aaa 
[1:51:56] vip GodliestCat64: catPls Aaah 
[1:51:57] premium DinnerCalzone: AAAAAAAAAA 
[1:51:58] subscriber premium Kythuulu: ahhhhh 
[1:51:59] twitch-recap-2023 wallacewellactually: @n0tthedoctor If youre talking about scary godmother you'd better take that back. 
[1:52:00] Lyvash: aaaah 
[1:52:13] BLCeee: RIP santa 
[1:52:13] twitch-recap-2023 GigiWuzHere_: Grandpa's wig? wideHUH
[1:52:14] rplace-2023 netyuui: catPls grandma broke her spine 
[1:52:15] Boscodbear: thanks to my parents i didnt have to watch this due to getting a wii 
[1:52:17] subscriber snosa: santa's gpogmg tp jail 
[1:52:22] vip Babbott_Orion: lol 
[1:52:25] vip Babbott_Orion: That part of the song 
[1:52:27] superultracombo-2023 rattletrap69: PLAYS WITH ELVES D:
[1:52:28] Bladestorm01: DinoDance DinoDance DinoDance DinoDance
[1:52:31] subscriber twitch-recap-2023 n0tthedoctor: @maxzlock I never watched this in full either until now. This was pretty bad 
[1:52:32] thedoodler303: @wallacewellsanally Fine... it has some redeeming qualities 
[1:52:32] Lyvash: At least they realize it too 
[1:52:34] vip artist-badge Guardison: (Deceased) 
[1:52:34] bits nyeaszel: ododno 
[1:52:35] vip twitch-recap-2023 squirrelcabinet: buhCat
[1:52:36] bits nyeaszel: odoNo
[1:52:37] subscriber premium neffpls: (DECEASED) 
[1:52:37] subscriber partner Temiree: (DECEASED) 
[1:52:38] Boscodbear: DEAD 
[1:52:38] vip GodliestCat64: odoNo
[1:52:38] subscriber superultracombo-2023 D_tector008: 9deceased) 
[1:52:39] Artacus: rip 
[1:52:40] subscriber premium KamiGousama: F 
[1:52:42] twitch-recap-2023 GigiWuzHere_: Buhh end 
[1:52:42] sub-gift-leader divind95: rip 
[1:52:43] vip artist-badge Guardison: papaPlz I'm here now 
[1:52:44] twitch-recap-2023 Fireborn: deadass
[1:52:48] vip GodliestCat64: lmao 
[1:52:52] Boscodbear: but were the reindeer harmed 
[1:52:55] DumboAKAwumbo: fruitcake disclaimer HUHH
[1:52:56] broadcaster turbo GreatSphynx: osmo trying to eat my feet 
[1:52:58] bits nyeaszel: FRCO 
[1:52:59] BLCeee: this didnt actually happen??? 
[1:53:00] premium X_eroz: cirCop This is your last time Santa, get em boys, 
[1:53:00] Bladestorm01: KILLED BY SANTA (DEACEASED) 
[1:53:00] twitch-recap-2023 wallacewellactually: frco 
[1:53:00] vip twitch-recap-2023 squirrelcabinet: osmoD
[1:53:01] thedoodler303: osmoStare
[1:53:02] subscriber premium neffpls: osmoLick
[1:53:02] subscriber twitch-recap-2023 Piyokopyo: Tasty
[1:53:03] subscriber sub-gifter maxzlock: osmoLick
[1:53:04] superultracombo-2023 rattletrap69: thank god the producers were SPARED the ire of fruitcake enjoyers 
[1:53:04] subscriber snosa: osmoLick
[1:53:05] twitch-recap-2023 franceybear: osmoLick
[1:53:06] rplace-2023 netyuui: osmoStare
[1:53:06] premium Zanclodon: I do love a good fruitcake 
[1:53:07] vip artist-badge Guardison: osmoLick
[1:53:08] subscriber solberserker: osmoBlep
[1:53:08] superultracombo-2023 rattletrap69: thank GOD 
[1:53:09] subscriber sofasofia: osmoLick
[1:53:10] hillbillyinablimp: gripper muncher 
[1:53:11] superultracombo-2023 rattletrap69: ITS OGREEEEEE 
[1:53:11] twitch-recap-2023 GigiWuzHere_: osmoD
[1:53:13] subscriber malty_meatia: Feast, Omo osmoD
[1:53:13] vip artist-badge Guardison: he's on the attack 
[1:53:15] Bobbler386: That's a great logo 
[1:53:15] subscriber partner Temiree: osmoLick
[1:53:19] subscriber overwatch-league-insider_1 Howoriginal: Clap gongo
[1:53:21] vip premium plorf: omo stak 
[1:53:22] univers__ltd: omg that logo 
[1:53:22] BLCeee: Clap
[1:53:24] subscriber JoGoBeans: free feet? osmoD
[1:53:25] Blocknight1: osmoLick
[1:53:25] subscriber BingsF: thank gongo
[1:53:29] broadcaster turbo GreatSphynx: !break 
[1:53:29] moderator partner Nightbot: It's time for a break, don't go away. 3min of ads will play so you don't have to see any ads for the next hour. Otherwise chill and enjoy the music. 
[1:53:31] vip artist-badge Guardison: the gongoatse 
[1:53:33] Bubsla: Clap
[1:53:35] bits nyeaszel: MOREGO OYOTrip
[1:53:36] subscriber twitch-recap-2023 n0tthedoctor: @wallacewellsanally Nah I was referring to what we just watched 
[1:53:36] mick_sq: WARF WARF WARF WARF
[1:53:36] subscriber snosa: lol 
[1:53:38] glitchcon2020 DeadheadJackal: Grandma Will Return in The Passion of the Christ 2 
[1:53:39] hillbillyinablimp: Cartoon Network really went out of their way to make me hate that song growing up huh 
[1:53:41] twitch-recap-2023 wallacewellactually: It's time for a brerb, don't go awawa. 3min of ass will play so you don't have to swooce any ass for the next hooh. Otherwise cheech and enjoy the m. mmmmmmmm 
[1:53:45] vip twitch-recap-2023 squirrelcabinet: catJamrgb
[1:53:46] vip artist-badge Guardison: oh no lmao 
[1:53:47] DumboAKAwumbo: Funnywhitecat5
[1:53:47] rplace-2023 netyuui: jmikeTech gongo jmikeTech
[1:53:47] subscriber superultracombo-2023 D_tector008: OH SHIR 
[1:53:48] subscriber JoGoBeans: wideVIBE
[1:53:48] subscriber twitch-recap-2023 Piyokopyo: RobertJam
[1:53:48] superultracombo-2023 Mattmatatt: lmao hell yeah 
[1:53:48] premium X_eroz: cirRave
[1:53:48] Bladestorm01: DinoDance DinoDance DinoDance DinoDance
[1:53:49] subscriber snosa: catJammingPolitely
[1:53:49] bits nyeaszel: catJAMGF
[1:53:49] deworming_in_progress: UNCLE SAMSONITE 
[1:53:50] Blocknight1: LUL
[1:53:50] vip premium plorf: honseWalk
[1:53:51] subscriber premium KamiGousama: yoooooo???? 
[1:53:51] subscriber premium Kythuulu: catJAMGF
[1:53:51] superultracombo-2023 Mattmatatt: MY PONY 
[1:53:52] twitch-recap-2023 Fireborn: carlPls uh oh
[1:53:52] subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM
[1:53:52] subscriber sofasofia: videochessBuny videochessBuny videochessBuny
[1:53:53] sub-gift-leader divind95: burpcore 
[1:53:55] vip twitch-recap-2023 viahate: boonDance boonDance boonDance boonDance
[1:53:56] SushiGummy: Corb
[1:53:56] subscriber malty_meatia: Yeat
[1:53:56] twitch-recap-2023 WolfzenSkiigh: catJammingPolitely
[1:53:57] subscriber sub-gifter maxzlock: catJamrgb
[1:53:57] RDSk: BYEAH 
[1:53:58] rplace-2023 netyuui: catJAMGF
[1:53:59] subscriber twitch-recap-2023 carlysle_: catJAMGF
[1:53:59] vip premium plorf: honseSpin
[1:54:01] hillbillyinablimp: catJAMGF
[1:54:02] crystalgears: Yeat Yeat
[1:54:03] Blocknight1: catJAMGF
[1:54:04] xx_noobslaya_xx: jarJAM jarJAM
[1:54:04] Artacus: Jojo 
[1:54:05] subscriber twitch-recap-2023 Piyokopyo: catJAMGF byeah 
[1:54:05] CoinDropperTim: codkhaLeesdance
[1:54:05] vip artist-badge Guardison: quarkDance
[1:54:06] Duckiestrides: god 
[1:54:06] twitch-recap-2023 franceybear: catJammingPolitely
[1:54:06] rplace-2023 netyuui: catJAM
[1:54:08] Lyvash: carlPls
[1:54:10] univers__ltd: Funnywhitecat5
[1:54:12] mick_sq: VoteYea VoteYea VoteYea
[1:54:12] subscriber superultracombo-2023 D_tector008: greats8JAM greats8JAM greats8JAM greats8JAM
[1:54:13] turbo nivis_shadoth: carlPls carlPls carlPls
[1:54:15] subscriber twitch-recap-2023 n0tthedoctor: greats8Bounce greats8Bounce greats8Bounce greats8Bounce
[1:54:17] sub-gift-leader divind95: funnywhitecat5
[1:54:18] BLCeee: VoteYea
[1:54:20] subscriber KatalepsyKills: funnywhitecat5
[1:54:22] subscriber malty_meatia: Corb Corb Corb
[1:54:25] subscriber superultracombo-2023 D_tector008: this makes we wanna FUCK 
[1:54:27] Duckiestrides: my PONY 
[1:54:32] broadcaster turbo GreatSphynx: this is grandma's favorite song 
[1:54:33] subscriber kakabookake: Funnywhitecat5 Funnywhitecat5 Funnywhitecat5
[1:54:34] Lyvash: kermiePls
[1:54:35] subscriber snosa: honseWalk
[1:54:38] Bladestorm01: MEETING of the BYEAH 
[1:54:42] vip premium plorf: MorshuRTX
[1:54:43] Blocknight1: honseWalk
[1:54:44] subscriber premium KamiGousama: he claims this song was never mean to be dirty 
[1:54:44] subscriber twitch-recap-2023 carlysle_: BERMUS
[1:54:46] subscriber kakabookake: LUL
[1:54:47] vip twitch-recap-2023 viahate: crumpO crumpO crumpO
[1:54:50] moderator founder turbo Dragoneye77: !CUM 
[1:54:50] moderator partner Nightbot: Roiker MilkTime BERMUS MilkTime Roiker MilkTime
[1:54:51] twitch-recap-2023 Fireborn: honseSpin
[1:54:54] broadcaster turbo GreatSphynx: its about horses 
[1:54:56] sub-gift-leader divind95: lol it wasn't that horny 
[1:55:00] superultracombo-2023 rattletrap69: honseSpin honseSpin honseSpin honseSpin honseSpin honseSpin honseSpin honseSpin honseSpin honseSpin
[1:55:02] turbo nivis_shadoth: honseWalk
[1:55:02] subscriber twitch-recap-2023 n0tthedoctor: This still sounds fresh af 
[1:55:03] moderator founder turbo Dragoneye77: chat 
[1:55:05] subscriber sub-gifter maxzlock: I hope you all had a merry crumus, ty for Gongo mr. Sphynx 
[1:55:06] moderator founder turbo Dragoneye77: do you want some new osmo lore 
[1:55:07] subscriber premium KamiGousama: hort 
[1:55:08] Bladestorm01: honse 
[1:55:08] subscriber twitch-recap-2023 n0tthedoctor: greats8Bounce greats8Bounce greats8Bounce greats8Bounce
[1:55:14] subscriber superultracombo-2023 D_tector008: nintendesiFilm nintendesiBeMyRose nintendesiFingering nintendesiSnifit
[1:55:15] subscriber twitch-recap-2023 Piyokopyo: yes greats8Ytrip
[1:55:15] turbo nivis_shadoth: RELEASE THE OSMO LORE 
[1:55:16] subscriber snosa: yes 
[1:55:23] Origfx: oh SHIT, good song 
[1:55:26] Origfx: jarJAM
[1:55:28] turbo nivis_shadoth: the forbidden text. 
[1:55:29] moderator founder turbo Dragoneye77: Osmo name isnt inspired by Cosmos that is jape 
[1:55:32] vip twitch-recap-2023 viahate: Funnywhitecat5 Funnywhitecat5 Funnywhitecat5 Funnywhitecat5
[1:55:34] subscriber twitch-recap-2023 Piyokopyo: D:
[1:55:35] subscriber snosa: WHAT
[1:55:36] vip Babbott_Orion: Olive the other Reinder tiem pogona10dollars
[1:55:37] moderator founder turbo Dragoneye77: his name is actually based off Sphynxs FAVORITE movie 
[1:55:38] turbo nivis_shadoth: OYOTrip
[1:55:38] vip twitch-recap-2023 Korokun: My Christmas was spent held hostage at a family party more than 6 hours 
[1:55:39] subscriber malty_meatia: Hope everyone is having a Happy Boxing Day 
[1:55:40] moderator founder turbo Dragoneye77: Osmosis Jones 
[1:55:43] superultracombo-2023 rattletrap69: its inspired by Osmosis Jones 
[1:55:44] subscriber snosa: wow 
[1:55:44] subscriber twitch-recap-2023 Piyokopyo: i knew it 
[1:55:45] vip uforgot: honseSpin
[1:55:45] superultracombo-2023 rattletrap69: I KNEW IT 
[1:55:50] sub-gift-leader divind95: OYOTrip til 
[1:55:53] subscriber twitch-recap-2023 Piyokopyo: Plinktosis
[1:55:55] broadcaster turbo GreatSphynx: ive never seen that 
[1:55:59] moderator founder turbo Dragoneye77: good 
[1:56:01] turbo nivis_shadoth: osmoD my life is a lie. 
[1:56:02] moderator founder turbo Dragoneye77: we can watch it next week 
[1:56:03] vip artist-badge Guardison: it's certainly a movie 
[1:56:05] moderator founder turbo Dragoneye77: greats8Osmopat
[1:56:08] vip twitch-recap-2023 viahate: I will never forget pimple scene 
[1:56:09] sub-gift-leader divind95: it's...a movie 
[1:56:09] subscriber twitch-recap-2023 Piyokopyo: do that greats8OTrip
[1:56:09] subscriber snosa: me neither 
[1:56:11] subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8Bounce greats8JAM greats8Bounce greats8JAM
[1:56:14] superultracombo-2023 rattletrap69: @Piyokopyo what an unbelievable gif holy shit 
[1:56:16] moderator founder turbo Dragoneye77: osmosis jones is honestly gongo material 
[1:56:17] vip artist-badge Guardison: The villain is bad ass 
[1:56:19] vip twitch-recap-2023 Korokun: It's weird but it has its moments 
[1:56:21] LarcBark: gongo
[1:56:23] twitch-recap-2023 NastyRedX: sup gongoloids 
[1:56:24] subscriber snosa: ppl wanna fuck the virus 
[1:56:25] subscriber twitch-recap-2023 ocarina_boy: I remember liking olive as a kid 
[1:56:25] superultracombo-2023 Mattmatatt: ebola? 
[1:56:26] Bladestorm01: wait a minute 
[1:56:26] sub-gift-leader divind95: the pimple scene makes me gag 
[1:56:28] bits nyeaszel: @Piyokopyo monkaS
[1:56:30] subscriber twitch-recap-2023 n0tthedoctor: greats8Gongo
[1:56:32] moderator founder turbo Dragoneye77: wait 
[1:56:34] subscriber premium KamiGousama: monkaS
[1:56:35] superultracombo-2023 Mattmatatt: I loved Osmosis Jones as a kid 
[1:56:36] turbo nivis_shadoth: i cringe at some of the live action scenes. 
[1:56:37] twitch-recap-2023 NastyRedX: the stream OYOTrip
[1:56:38] superultracombo-2023 rattletrap69: the pimple scene is so good 
[1:56:40] superultracombo-2023 rattletrap69: so gross 
[1:56:41] moderator founder turbo Dragoneye77: sphynx did babbot just send you a bunch of chrimbo things 
[1:56:43] broadcaster turbo GreatSphynx: there are live action scenes? 
[1:56:45] Origfx: Funnywhitecat5
[1:56:46] moderator founder turbo Dragoneye77: Yes 
[1:56:47] subscriber twitch-recap-2023 Piyokopyo: yes 
[1:56:48] vip twitch-recap-2023 Korokun: Yeah 
[1:56:49] moderator founder turbo Dragoneye77: theyre so bad 
[1:56:49] broadcaster turbo GreatSphynx: no 
[1:56:51] bits nyeaszel: monkaS 󠀀 
[1:56:51] thedoodler303: @GreatSphynx Yes 
[1:56:51] vip artist-badge Guardison: it's half live action half cartoon 
[1:56:52] broadcaster turbo GreatSphynx: ? 
[1:56:57] moderator founder turbo Dragoneye77: the live action scenes 
[1:56:57] subscriber snosa: ? 
[1:56:57] Blocknight1: cuz its a real guys body 
[1:56:57] subscriber twitch-recap-2023 Piyokopyo: it all takes place inside of bill murray's body 
[1:56:57] vip twitch-recap-2023 Korokun: It has Bill Murray 
[1:56:58] mick_sq: @GreatSphynx On the movie (not the show) 
[1:56:58] sub-gift-leader divind95: the live action is bill murray 
[1:57:01] subscriber overwatch-league-insider_1 Howoriginal: I love when the guy said LEEEGGGG 
[1:57:03] subscriber malty_meatia: Live action with Bill Murray no less 
[1:57:03] horsephallusdan: catJamrgb
[1:57:04] vip GodliestCat64: Osmosis jones sucks 
[1:57:04] Dust1210: the tv show didn't iirc, the movie did 
[1:57:04] turbo nivis_shadoth: they show a real corpse. 
[1:57:08] bits nyeaszel: oh shit mangongo effect 
[1:57:12] Bladestorm01: yes with a monkey and bill murray 
[1:57:12] thedoodler303: catJAMM Riding my pony 
[1:57:13] subscriber superultracombo-2023 D_tector008: ozzy and drix was the animated series 
[1:57:13] superultracombo-2023 rattletrap69: @GodliestCat64 wtf D:
[1:57:14] turbo nivis_shadoth: and enter it with a small camera 
[1:57:14] moderator founder turbo Dragoneye77: @GreatSphynx babbot did grandma gets murdered and then olive in desert discord the other week 
[1:57:16] vip twitch-recap-2023 Korokun: TV show was all cartoon 
[1:57:20] vip uforgot: honseWalk
[1:57:24] moderator founder turbo Dragoneye77: so I thought he sent those to you to 
[1:57:24] hillbillyinablimp: I never understood why they were in Bill Murray in the movie but in the show they were in some kid 
[1:57:27] vip GodliestCat64: It's a movie for sure 
[1:57:27] subscriber snosa: OYOTrip olive the other reindeer?? 
[1:57:28] vip artist-badge Guardison: Olive the Other Reindeer is so good 
[1:57:29] broadcaster turbo GreatSphynx: he sent me the last thing but i already had it 
[1:57:31] subscriber snosa: olive huge 
[1:57:33] vip artist-badge Guardison: my favorite christmas special 
[1:57:33] superultracombo-2023 rattletrap69: honseWalk honseWalk honseWalk honseWalk
[1:57:36] subscriber superultracombo-2023 D_tector008: @hillbillyinablimp they migrated to the kid 
[1:57:46] vip twitch-recap-2023 viahate: MorshuRTX MorshuRTX MorshuRTX
[1:57:46] mick_sq: They "migrated" on a sneeze IIRC 
[1:57:46] subscriber superultracombo-2023 D_tector008: @hillbillyinablimp decided to stay 
[1:57:49] thedoodler303: honseWalk honseWalk honseWalk honseWalk
[1:57:49] broadcaster turbo GreatSphynx: !break 
[1:57:49] moderator partner Nightbot: It's time for a break, don't go away. 3min of ads will play so you don't have to see any ads for the next hour. Otherwise chill and enjoy the music. 
[1:57:51] subscriber snosa: olive is my family's christmas thing 
[1:57:54] twitch-recap-2023 wallacewellactually: It's time for a brerb, don't go awawa. 3min of ass will play so you don't have to swooce any ass for the next hooh. Otherwise cheech and enjoy the m. mmmmmmmm 󠀀 
[1:57:59] sub-gift-leader divind95: marketing-wise, middle-aged man isn't great for a kids show 
[1:58:03] vip twitch-recap-2023 squirrelcabinet: catPls
[1:58:03] subscriber twitch-recap-2023 Piyokopyo: catPls
[1:58:04] subscriber snosa: catPls
[1:58:05] thedoodler303: catPls
[1:58:05] thetwitch3r: catPls
[1:58:06] subscriber JoGoBeans: wideVIBE
[1:58:06] vip twitch-recap-2023 viahate: catPls catPls catPls catPls
[1:58:07] subscriber overwatch-league-insider_1 Howoriginal: Gorillaz vineMeatpog
[1:58:07] bits nyeaszel: OYOTrip BRERB 
[1:58:07] subscriber premium Kythuulu: catPls
[1:58:08] moderator founder turbo Dragoneye77: yo 
[1:58:09] subscriber snosa: yesss 
[1:58:09] vip premium plorf: VIBE
[1:58:10] subscriber premium KamiGousama: YES 
[1:58:10] twitch-recap-2023 wallacewellactually: i liked the tangerine bear in terms of xmas specials, its not the best but its cute 
[1:58:11] hillbillyinablimp: catPls catPls catPls catPls catPls
[1:58:11] turbo nivis_shadoth: last living souls 
[1:58:12] sub-gift-leader divind95: CatGuitar
[1:58:12] subscriber sub-gifter maxzlock: yeahhhh 
[1:58:13] vip premium plorf: i love this song 
[1:58:13] subscriber lKazii: catJAMM
[1:58:18] twitch-recap-2023 Fireborn: jarJAM
[1:58:19] moderator founder turbo Dragoneye77: sphynx playing normie music 
[1:58:21] subscriber premium neffpls: the grillers OYOTrip
[1:58:22] moderator founder turbo Dragoneye77: its really christmas 
[1:58:22] thedoodler303: Gorillaz yes 
[1:58:25] subscriber snosa: wideVIBE
[1:58:28] thedoodler303: catJAMM
[1:58:32] moderator founder turbo Dragoneye77: jarJAM
[1:58:33] terrancejones: 1 raiders from terrancejones have joined! 
[1:58:33] deworming_in_progress: gojira 🦍 
[1:58:34] subscriber JoGoBeans: It should be legally required to play the intro to Demon Dayz before Last Living Souls 
[1:58:36] subscriber malty_meatia: NESSIE NESSIE NESSIE
[1:58:38] subscriber snosa: hi terrance 
[1:58:38] hillbillyinablimp: catPls catPls catPls catPls catPls catPls catPls catPls catPls catPls
[1:58:39] bits nyeaszel: OYOTrip RAIDO 
[1:58:43] broadcaster turbo GreatSphynx: nice osmo just spilled my water 
[1:58:44] terrancejones: Hey Howdy Hey, good evenings! 
[1:58:44] broadcaster turbo GreatSphynx: brb 
[1:58:48] subscriber snosa: oh no 
[1:58:49] thedoodler303: osmoStare
[1:58:50] bits nyeaszel: osmoD
[1:58:50] moderator founder turbo Dragoneye77: OSMO THE DEMON 
[1:58:51] subscriber JoGoBeans: osmoD oops 
[1:58:52] subscriber premium neffpls: he's thirsty 
[1:58:53] crystalgears: osmoStare
[1:58:55] turbo nivis_shadoth: I still love listening to fire coming out of the monkey's head. 
[1:58:55] vip twitch-recap-2023 Korokun: The menace returns 
[1:58:55] sub-gift-leader divind95: osmoD
[1:58:56] moderator founder turbo Dragoneye77: greats8Osmopat
[1:58:57] Spie812: osmoLick
[1:58:59] subscriber twitch-recap-2023 Piyokopyo: osmoD gimme hydration 
[1:59:04] Lyvash: carlPls
[1:59:05] vip artist-badge Guardison: osmoD I'll do it again 
[1:59:06] hillbillyinablimp: osmoLick Untameable osmoLick
[1:59:07] vip uforgot: atamJam atamBop
[1:59:07] terrancejones: How's the awesome tonight? 
[1:59:08] moderator founder turbo Dragoneye77: its a good thing i didnt do an osmo bet 
[1:59:09] subscriber snosa: osmoD <-- thorsty 
[1:59:10] montrith: Osmp sabotaging Gongo again 
[1:59:13] subscriber malty_meatia: GettingJiggyWithIt
[1:59:14] moderator founder turbo Dragoneye77: believers would be coping 
[1:59:18] mick_sq: Sometimes I want to comment the Twitch commercials I get with you guys, then I remember y'all don't see the same thing :(
[1:59:24] Origfx: jarJAM
[1:59:25] broadcaster turbo GreatSphynx: he already interupted like 3 times 
[1:59:28] moderator founder turbo Dragoneye77: good 
[1:59:29] deworming_in_progress: DIESOFCRINGE <-- the cup of water when osmo comes near 
[1:59:30] subscriber snosa: getupgetupgetupgetup 
[1:59:31] moderator founder turbo Dragoneye77: hes a good cat 
[1:59:34] vip GodliestCat64: He's evil tonight 
[1:59:34] xexsxexs: !cornography 
[1:59:34] moderator partner Nightbot: Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn Corn
[1:59:37] vip twitch-recap-2023 Korokun: Oh right I'm getting no ads cuz I got a gift sub 
[1:59:38] subscriber snosa: CORN
[1:59:39] thedoodler303: CORN
[1:59:41] subscriber premium neffpls: CORN
[1:59:41] superultracombo-2023 rattletrap69: Corn
[1:59:42] vip twitch-recap-2023 squirrelcabinet: chatPls
[1:59:44] moderator founder turbo Dragoneye77: Osmo HATES Christmas 
[1:59:45] bits nyeaszel: osmo broadcast intrusion monjas 
[1:59:45] superultracombo-2023 rattletrap69: CORN
[1:59:45] subscriber twitch-recap-2023 Piyokopyo: CORN
[1:59:46] subscriber JoGoBeans: btw either Spotify or Damon Albarn ruined the Demon Dayz album by getting rid of the song transitions, shit sucks RAGEY
[1:59:46] subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM
[1:59:49] moderator founder turbo Dragoneye77: he celebrates Kwanza 
[1:59:50] superultracombo-2023 rattletrap69: CORN Corn CORN
[1:59:53] vip premium plorf: wideVIBE
[2:00:00] vip twitch-recap-2023 Korokun: @mick_sq I get the same urge sometimes too 
[2:00:04] subscriber malty_meatia: @korokun I had the same moment of confusion last night 
[2:00:09] subscriber snosa: catPls
[2:00:13] moderator founder turbo Dragoneye77: god i forgot how good this song is 
[2:00:19] subscriber snosa: yea it fucks 
[2:00:21] twitch-recap-2023 wallacewellactually: what twitch commercials do you guys get over and over again 
[2:00:26] subscriber twitch-recap-2023 n0tthedoctor: greats8Gongo
[2:00:29] subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM greats8JAM
[2:00:30] vip uforgot: catBlink DrumTime
[2:00:32] subscriber JoGoBeans: @wallacewellsanally ublock lol 
[2:00:33] moderator founder turbo Dragoneye77: I bought little dark age on vinyl along with a record from Franz Ferdinand 
[2:00:37] thedoodler303: @JoGo_ jmikeSadbungle A lot of songs I used to listen to with the transitions don't do it seamlessly anymore 
[2:00:47] mick_sq: Mostly really obnocious PS5 and laptop ones 
[2:00:47] subscriber snosa: oh i love little dark age v nice 
[2:00:51] bits nyeaszel: a mastercard NFT ad and FPS league of legends 
[2:00:52] vip twitch-recap-2023 squirrelcabinet: used to get bunch of cat ads Crunch
[2:00:52] moderator founder turbo Dragoneye77: you'll like king gizzard @thedoodler303 
[2:00:58] broadcaster turbo GreatSphynx: i have to find osmo's bird hes going mental 
[2:00:59] moderator founder turbo Dragoneye77: they do transitions into their songs 
[2:01:00] deworming_in_progress: i keep getting the Moutnain Dew Raid ad despite the raid thing being only available December 8 
[2:01:02] subscriber JoGoBeans: @thedoodler303 they think the transitions would be too jarring for people listening to a randomized playlist 
[2:01:04] vip twitch-recap-2023 squirrelcabinet: osmoLick
[2:01:05] Origfx: !osmo 
[2:01:06] moderator partner Nightbot: osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick osmoLick
[2:01:06] vip twitch-recap-2023 Korokun: I specifically turn off ublock for this stream 
[2:01:09] subscriber snosa: osmoLick wild n crazy!!!!! 
[2:01:15] bits nyeaszel: BERMAD WHERE IS BUSY BIRD 
[2:01:15] moderator founder turbo Dragoneye77: but korokun 
[2:01:17] broadcaster turbo GreatSphynx: im gonna do one more break i think so i dont have to use 3 snoozes for the next thing 
[2:01:17] moderator founder turbo Dragoneye77: youre subbed 
[2:01:19] broadcaster turbo GreatSphynx: siorry 
[2:01:23] moderator founder turbo Dragoneye77: siorry 
[2:01:24] twitch-recap-2023 WolfzenSkiigh: NotLikeThis osmoLick Find Bird 
[2:01:26] subscriber snosa: siorry 
[2:01:30] subscriber twitch-recap-2023 Piyokopyo: osmoStare INCORRIGIBLE 
[2:01:30] vip GodliestCat64: You're good 
[2:01:31] twitch-recap-2023 wallacewellactually: the microsoft ai laptop assistant one gets on my last nerves it has the most annoying song 
[2:01:33] bits nyeaszel: slorry 
[2:01:35] bits nyeaszel: MorshuPls
[2:01:35] vip artist-badge Guardison: oh hell yeah 
[2:01:36] vip twitch-recap-2023 Korokun: Only as of yesterday 
[2:01:37] moderator founder turbo Dragoneye77: fart core 
[2:01:37] superultracombo-2023 rattletrap69: siorry in stereo 
[2:01:37] vip artist-badge Guardison: all alone 
[2:01:39] Origfx: Funnywhitecat5
[2:01:39] sub-gift-leader divind95: MorshuPls
[2:01:40] subscriber sub-gifter maxzlock: all alone 
[2:01:40] subscriber JoGoBeans: catPls
[2:01:44] vip artist-badge Guardison: Funnywhitecat5
[2:01:45] thedoodler303: Funnywhitecat5
[2:01:45] subscriber snosa: w! catPls hooooooooooough 
[2:01:46] subscriber overwatch-league-insider_1 Howoriginal: Fly in my soup song :)
[2:01:46] superultracombo-2023 rattletrap69: BRAP core 
[2:01:47] subscriber twitch-recap-2023 n0tthedoctor: greats8Bounce greats8Bounce greats8Bounce greats8Bounce greats8Bounce greats8Bounce
[2:01:49] subscriber twitch-recap-2023 Piyokopyo: ppL all alone 
[2:01:50] vip twitch-recap-2023 viahate: catJamrgb catJamrgb catJamrgb catJamrgb
[2:01:51] subscriber premium KamiGousama: im trying to sleep stop playing bangers LUL
[2:01:51] vip uforgot: kirkBASS SaxTime
[2:01:53] subscriber sofasofia: catPls
[2:01:54] subscriber premium neffpls: gorilers again Funnywhitecat5
[2:01:56] cheapsushidragon: ratJAM
[2:01:56] mick_sq: VERY stanky 
[2:01:57] SushiGummy: GLEEBING
[2:01:57] premium cosmonaughtbob: love the otamatone :)
[2:01:59] deworming_in_progress: Funnywhitecat5 this song plays in the white void in that one spongebob episode 
[2:01:59] subscriber JoGoBeans: catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM
[2:02:00] bits nyeaszel: gongo do be vinbin 
[2:02:00] vip twitch-recap-2023 squirrelcabinet: Funnywhitecat5
[2:02:00] Artacus: catYAM2
[2:02:01] vip premium plorf: i used to memorize this rap 
[2:02:04] Origfx: catJAM
[2:02:08] subscriber snosa: catJAM catJAM catJAM
[2:02:08] broadcaster turbo GreatSphynx: also i can look for bird 
[2:02:08] twitch-recap-2023 NastyRedX: NastyRedX gifted a Tier 1 sub to wallacewellsanally! 
[2:02:08] twitch-recap-2023 NastyRedX: NastyRedX is paying forward the Gift they got from explodes5 to wallacewellsanally! 
[2:02:12] thedoodler303: catJAM catJAM catJAM catJAM catJAM
[2:02:17] bits nyeaszel: OYOTrip
[2:02:17] subscriber snosa: OYOTrip
[2:02:18] moderator founder turbo Dragoneye77: hey chat 
[2:02:19] vip uforgot: this is max patGlu Tasty
[2:02:22] broadcaster turbo GreatSphynx: ty red 
[2:02:23] xx_noobslaya_xx: catJammingPolitely
[2:02:25] vip twitch-recap-2023 viahate: catJAM catJAM catJAM catJAM
[2:02:27] vip GodliestCat64: Funnywhitecat5
[2:02:29] moderator founder turbo Dragoneye77: look at my baldis basics gate 3 character 
[2:02:30] subscriber twitch-recap-2023 Piyokopyo: MorshuPls
[2:02:31] moderator founder turbo Dragoneye77: https://cdn.discordapp.com/attachments/704185090749759578/1189080046997078127/image.png?ex=659cdc17&is=658a6717&hm=551a38a25cffe59d026502e2bb7aa71bfe562857192a78305a3d91edc5a39fcc& 
[2:02:32] subscriber snosa: catJAM catJAM catJAM
[2:02:32] subscriber twitch-recap-2023 wallacewellactually: OYOTrip THANK YOU 
[2:02:32] subscriber JoGoBeans: btw chat if you hated Humanz when it first came out, give it another listen, I ended up liking it after years of its release 
[2:02:32] superultracombo-2023 rattletrap69: catJam 
[2:02:34] xx_noobslaya_xx: catJAM
[2:02:35] subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8Bounce greats8JAM greats8Bounce greats8JAM greats8Bounce greats8JAM
[2:02:35] superultracombo-2023 rattletrap69: catJAM
[2:02:35] cheapsushidragon: ratJAM ratJAM ratJAM ratJAM
[2:02:36] Origfx: popCat Funnywhitecat5 popCat Funnywhitecat5 popCat Funnywhitecat5 popCat Funnywhitecat5 popCat Funnywhitecat5
[2:02:39] premium cosmonaughtbob: vargFloss vargFloss vargFloss vargFloss
[2:02:41] bits nyeaszel: funnywhitecat5 Funnywhitecat5 funnywhitecat5
[2:02:42] vip premium plorf: w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX w! MorshuRTX
[2:02:43] twitch-recap-2023 WolfzenSkiigh: morshuPls 
[2:02:43] subscriber snosa: @Dragoneye77 slay 
[2:02:45] subscriber malty_meatia: GettingJiggyWithIt GettingJiggyWithIt GettingJiggyWithIt GettingJiggyWithIt GettingJiggyWithIt
[2:02:46] vip uforgot: atamBop popCat
[2:02:49] sub-gifter NastyRedX: greats8Daxmug kill each other greats8Daxmug
[2:02:52] mick_sq: goblinPls goblinPls goblinPls
[2:02:53] subscriber premium neffpls: @Dragoneye77 white man jumpscare 
[2:02:54] subscriber JoGoBeans: MorshuPls
[2:02:55] vip GodliestCat64: What're you gonna name your bald grape character 
[2:02:57] vip twitch-recap-2023 viahate: popCat popCat popCat
[2:02:59] subscriber twitch-recap-2023 n0tthedoctor: greats8Bounce greats8Bounce greats8Bounce greats8Bounce greats8Bounce
[2:03:01] terrancejones: terran34Jevil stevanleDanceParty meowti1Rave jmikeSquandance
[2:03:02] subscriber sofasofia: videochessBuny videochessBuny videochessBuny
[2:03:03] moderator founder turbo Dragoneye77: I already named him 
[2:03:07] moderator founder turbo Dragoneye77: I fingered a brain earlier 
[2:03:11] vip Snudl: quarkDance quarkPls quarkDance MorshuPls quarkDance quarkPls quarkDance
[2:03:13] Origfx: HUHH
[2:03:13] Artacus: spinach 
[2:03:13] subscriber Hexagon_2: catJAMPARTY
[2:03:23] rplace-2023 ruxyy1337: shortytvCOP
[2:03:23] Origfx: birb-type beat 
[2:03:25] subscriber snosa: DataFingerbang
[2:03:27] vip uforgot: odoSoyL quarkDance odoSoyR
[2:03:32] moderator founder turbo Dragoneye77: someone called my character vinny 
[2:03:34] subscriber snosa: wideVIBE
[2:03:36] moderator founder turbo Dragoneye77: but i refuse to adjust 
[2:03:40] Artacus: zzooTrip
[2:03:43] horsephallusdan: wideVIBE
[2:03:46] Origfx: zzooTrip
[2:03:48] thedoodler303: wideVIBE
[2:03:49] vip twitch-recap-2023 viahate: wideVIBE
[2:03:51] turbo nivis_shadoth: zzooTrip
[2:03:53] subscriber JoGoBeans: wideVIBE
[2:03:56] subscriber kakabookake: catJAMGF Corb spynxHappi
[2:04:02] subscriber JoGoBeans: catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM
[2:04:07] vip premium plorf: catJAM
[2:04:07] vip twitch-recap-2023 squirrelcabinet: osmoLick
[2:04:09] subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM greats8JAM greats8JAM
[2:04:11] subscriber snosa: catJAM catJAM catJAM
[2:04:14] vip uforgot: Yeat DrumTime
[2:04:20] crystalgears: dorbSussy dorbSussy dorbSussy
[2:04:27] vip artist-badge Guardison: man I'm gonna have to listen through some Grillerz albums soon 
[2:04:34] mick_sq: bounceDok hapiCat bounceDok hapiCat bounceDok
[2:04:42] rplace-2023 ruxyy1337: greats8YoTrip why we livin 
[2:04:55] vip GodliestCat64: Grildas 
[2:04:56] mick_sq: @ruxyy1337 just to sufer 
[2:05:04] broadcaster turbo GreatSphynx: found the bird 
[2:05:06] deworming_in_progress: jmikeRatgirl
[2:05:08] bits nyeaszel: OYTrip
[2:05:08] subscriber snosa: nice 
[2:05:10] vip artist-badge Guardison: was it the word 
[2:05:12] superultracombo-2023 rattletrap69: bird, obtained 
[2:05:14] moderator founder turbo Dragoneye77: quick oswald bet 
[2:05:21] subscriber snosa: CatGuitar
[2:05:22] vip twitch-recap-2023 viahate: CatGuitar
[2:05:23] predictions subscriber JoGoBeans: catPls
[2:05:26] Bladestorm01: Oswald 
[2:05:40] predictions subscriber overwatch-league-insider_1 Howoriginal: Oswald? Does he know Maxwell? 
[2:05:40] predictions vip twitch-recap-2023 squirrelcabinet: osmoD
[2:05:42] rplace-2023 ruxyy1337: CatGuitar
[2:05:46] predictions subscriber premium neffpls: i am so ready to lose some quatloos 
[2:05:47] moderator founder turbo Dragoneye77: wooly muff 
[2:05:49] broadcaster turbo GreatSphynx: i also got a 50 pack of those whistling nerf darts for my nerf gun and i have been shooting them for osmo 
[2:05:55] moderator founder turbo Dragoneye77: NOO 
[2:05:58] moderator founder turbo Dragoneye77: DONT SHOOT THE OSMO
[2:05:59] subscriber malty_meatia: No faith in rascally Omo 
[2:06:01] bits nyeaszel: D:
[2:06:02] predictions thedoodler303: This artist sounds familiar 
[2:06:02] predictions subscriber snosa: lol 
[2:06:08] broadcaster turbo GreatSphynx: harvey danger 
[2:06:09] hillbillyinablimp: i wish I had a cat to shoot my nerf darts for 
[2:06:15] vip twitch-recap-2023 viahate: catJammingPolitely catJammingPolitely catJammingPolitely
[2:06:15] mick_sq: catYAM2
[2:06:17] hillbillyinablimp: i just modded my stryfe too 
[2:06:19] predictions subscriber twitch-recap-2023 Piyokopyo: osmoD 🔫 spynxSimp
[2:06:19] broadcaster turbo GreatSphynx: just not hte one song everyone knows 
[2:06:24] RDSk: im a frayed knot 
[2:06:24] predictions subscriber twitch-recap-2023 wallacewellactually: singer sounds a lot like ben folds LUL
[2:06:25] vip twitch-recap-2023 Korokun: Have you considered getting Osmo the wheel? 
[2:06:25] predictions subscriber snosa: my cat will only play with projectiles 
[2:06:32] broadcaster turbo GreatSphynx: its literally the track right after the song everyone knows 
[2:06:34] subscriber sub-gifter maxzlock: yeah i was gonna say is this the flagpole sitta guy 
[2:06:36] predictions deworming_in_progress: the wheel? monkaS
[2:06:40] hillbillyinablimp: like a younger ben folds I kinda see it 
[2:06:46] superultracombo-2023 Mattmatatt: this almost reminds me of Frank Turner's earlier stuff 
[2:06:49] subscriber kakabookake: train osmo to eat the moths taht get inside 
[2:06:54] predictions vip twitch-recap-2023 squirrelcabinet: CatGuitar
[2:06:56] predictions subscriber JoGoBeans: CatGuitar
[2:06:59] rplace-2023 ruxyy1337: picardAAH
[2:07:03] predictions Origfx: catJAM
[2:07:03] predictions vip twitch-recap-2023 squirrelcabinet: catJAM HYPERDRUMTIME
[2:07:04] predictions subscriber snosa: Yeat DrumTime
[2:07:07] predictions vip GodliestCat64: catJAM
[2:07:08] superultracombo-2023 Mattmatatt: man I should listen to more of this band other than that One Song 
[2:07:09] vip premium plorf: CatGuitar
[2:07:10] predictions Origfx: !catband 
[2:07:10] moderator partner Nightbot: catBoom CatGuitar catJAMGF DrumTime lilGoblin GuitarTime meow eGuitarTime popCat FluteTime catBoom catJAMM catJAMPARTY catJAMM catJAM
[2:07:11] predictions thedoodler303: @maxzlock Wait, almost everyone only knows him for that song? 
[2:07:15] subscriber malty_meatia: Yeat
[2:07:15] moderator founder turbo Dragoneye77: Osmo believers 
[2:07:17] moderator founder turbo Dragoneye77: I pray for you 
[2:07:26] broadcaster turbo GreatSphynx: yeah that song was like a one hit wonder 
[2:07:28] predictions Origfx: osmo is good kitty 
[2:07:29] vip premium plorf: is this the im not sick but im not well 
[2:07:35] broadcaster turbo GreatSphynx: yes lol 
[2:07:44] predictions hillbillyinablimp: thats the heart in a blender guy right 
[2:07:46] vip premium plorf: catJamrgb
[2:07:47] predictions superultracombo-2023 rattletrap69: is this Sex Bob-Omb 
[2:07:48] broadcaster turbo GreatSphynx: no lmao 
[2:07:49] mick_sq: NESSIE mikePls kermiePls
[2:07:51] broadcaster turbo GreatSphynx: thats eve six 
[2:08:02] predictions hillbillyinablimp: i thought all alt rock 90s one hit wonder bands were the same 
[2:08:04] superultracombo-2023 Mattmatatt: that song is giga ingrained in my brain from Peep Show 
[2:08:05] domelord420: these guys are better than youd think but still not that great 
[2:08:11] broadcaster turbo GreatSphynx: dataBruh
[2:08:12] moderator founder turbo Dragoneye77: sphynx 
[2:08:17] predictions thedoodler303: Huh, I guess I'm the few percent who didn't enjoy just flagpole 
[2:08:17] broadcaster turbo GreatSphynx: i only like this album tbf 
[2:08:22] moderator founder turbo Dragoneye77: one of my friends from jackals server 100% gongo earlier 
[2:08:23] predictions hillbillyinablimp: eve6 guy woulda told me this was him 
[2:08:27] moderator founder turbo Dragoneye77: the gongo virus has spread 
[2:08:33] subscriber kakabookake: Funnywhitecat5
[2:08:33] sub-gifter NastyRedX: Frank Turner mentioned greats8YoTrip
[2:08:33] vip premium plorf: eve6 guy is a twitter poster 
[2:08:41] domelord420: theyve got great heavy 90s production here 
[2:08:42] predictions vip GodliestCat64: Tell them to do a gongo speedrun now 
[2:08:44] predictions vip GodliestCat64: Kappa
[2:08:48] rplace-2023 ruxyy1337: gongo culture 
[2:08:52] premium Azeryth: what is this called? 
[2:08:54] premium Azeryth: I like it 
[2:08:59] broadcaster turbo GreatSphynx: wooly muffler by harvey danger 
[2:09:00] predictions subscriber snosa: gongo looked too broken to speedrun lol 
[2:09:07] predictions superultracombo-2023 rattletrap69: flute 
[2:09:15] predictions subscriber JoGoBeans: sounds 2000s 
[2:09:17] predictions subscriber JoGoBeans: is that right 
[2:09:19] broadcaster turbo GreatSphynx: 97 
[2:09:21] mick_sq: !gongo 
[2:09:21] moderator partner Nightbot: Gongo is a 2D side-scrolling platformer where the player goes through levels killing enemies and saving the princess. Each level has amazing hand-picked worlds. On each of the levels, a princess is hidden, which must be rescued and delivered to your castle, cleaning up enemies along the way. 
[2:09:22] predictions subscriber JoGoBeans: close enough 
[2:09:30] moderator founder turbo Dragoneye77: I made a discovery earlier tonight the gongo dev has like an entire catalog of gongo likes 
[2:09:31] premium Azeryth: Thank you! 
[2:09:31] broadcaster turbo GreatSphynx: dataBruh
[2:09:32] predictions thedoodler303: catJAMM
[2:09:34] moderator founder turbo Dragoneye77: including christmas games 
[2:09:37] broadcaster turbo GreatSphynx: dont give th em money 
[2:09:38] predictions vip twitch-recap-2023 Korokun: 5th anniversary of gongo will be a speedrun contest 
[2:09:43] broadcaster turbo GreatSphynx: !break 
[2:09:43] moderator partner Nightbot: It's time for a break, don't go away. 3min of ads will play so you don't have to see any ads for the next hour. Otherwise chill and enjoy the music. 
[2:09:45] predictions subscriber twitch-recap-2023 Piyokopyo: crimbus gongo greats8YoTrip
[2:09:45] subscriber premium KamiGousama: Clap
[2:09:46] subscriber malty_meatia: !spondor 
[2:09:46] moderator partner Nightbot: THIS STREAM SPONDOR BY GONGO 
[2:09:47] predictions subscriber twitch-recap-2023 wallacewellactually: It's time for a brerb, don't go awawa. 3min of ass will play so you don't have to swooce any ass for the next hooh. Otherwise cheech and enjoy the m. mmmmmmmm 
[2:09:55] Blocknight1: gungo 
[2:09:58] premium cosmonaughtbob: AlienDance
[2:09:59] predictions subscriber snosa: catJAM
[2:10:01] subscriber kakabookake: quarkDance
[2:10:02] superultracombo-2023 Mattmatatt: lol nice 
[2:10:03] predictions Origfx: catJAM catJAM catJAM catJAM catJAM
[2:10:04] mick_sq: gungan 
[2:10:04] sub-gifter NastyRedX: oh shit I know this one 
[2:10:04] predictions thedoodler303: CatGuitar
[2:10:04] superultracombo-2023 Mattmatatt: big tone shift 
[2:10:08] predictions vip twitch-recap-2023 squirrelcabinet: catJAM GuitarTime
[2:10:08] Blocknight1: AlienDance
[2:10:13] turbo nivis_shadoth: spanX GuitarTime
[2:10:19] predictions vip GodliestCat64: catJAM GuitarTime
[2:10:20] premium Azeryth: ooh what is this one called? 
[2:10:21] predictions thetwitch3r: catJAM
[2:10:21] subscriber malty_meatia: NESSIE NESSIE NESSIE
[2:10:22] subscriber sofasofia: catGuitar 
[2:10:24] predictions subscriber JoGoBeans: wideVIBE
[2:10:27] broadcaster turbo GreatSphynx: playing god by polyphia 
[2:10:27] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM GuitarTime
[2:10:29] vip twitch-recap-2023 viahate: catJAM
[2:10:30] subscriber twitch-recap-2023 carlysle_: catJAM
[2:10:31] premium cosmonaughtbob: Apt song for chrimbus 
[2:10:33] crystalgears: NESSIE NESSIE NESSIE
[2:10:34] twitch-recap-2023 Merak_r: catJAM
[2:10:36] predictions Origfx: w! catJAM w! GuitarTime
[2:10:39] rplace-2023 ruxyy1337: the wiki page for gongo is still hillarious 
[2:10:55] premium Azeryth: beautiful 
[2:10:56] subscriber kakabookake: MorshuPls not enough notes 
[2:10:58] predictions subscriber twitch-recap-2023 n0tthedoctor: I'll have to see it 
[2:11:14] predictions subscriber snosa: catJAM GuitarTime
[2:11:15] broadcaster turbo GreatSphynx: sorry in advance for the next thing 
[2:11:22] predictions Origfx: sweatFrog
[2:11:23] superultracombo-2023 Mattmatatt: I think my fave Polyphia song is ABC, love the vocals in that one 
[2:11:24] subscriber malty_meatia: monkaS
[2:11:24] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Daxmug
[2:11:24] subscriber kakabookake: greats8Daxmug
[2:11:25] predictions subscriber twitch-recap-2023 Piyokopyo: monkaS
[2:11:27] predictions sub-gift-leader divind95: daxMug
[2:11:28] premium cosmonaughtbob: greats8Daxmug
[2:11:29] broadcaster turbo GreatSphynx: catPls catPls catPls
[2:11:29] Blocknight1: i should really check out polyphia, i like culprate a lot and this has those vibes 
[2:11:36] moderator founder turbo Dragoneye77: greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE
[2:11:38] vip premium plorf: this reminds me of haywyre 
[2:11:41] predictions subscriber premium neffpls: greats8Daxmug greats8Daxmug greats8Daxmug
[2:11:43] predictions subscriber snosa: VIBE
[2:11:45] predictions vip GodliestCat64: noBrien The next thing 
[2:11:46] predictions subscriber JoGoBeans: wdym 
[2:11:46] predictions vip twitch-recap-2023 squirrelcabinet: osmoStare
[2:11:48] Blocknight1: haywyre too 
[2:11:57] predictions deworming_in_progress: daxMug ffzY
[2:11:57] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Bounce greats8JAM greats8Bounce
[2:11:58] hexam_project: A government-organized non-governmental organization (GONGO) is a non-governmental organization that was set up or sponsored by a government in order to further its political interests and mimic the civic groups and civil society at home, or promote its international or geopolitical interests abroad. 
[2:12:03] predictions subscriber twitch-recap-2023 n0tthedoctor: LUL
[2:12:05] predictions subscriber snosa: zzooTrip
[2:12:05] hexam_project: that gongo? Kappa
[2:12:08] subscriber kakabookake: MorshuPls catJAMGF Funnywhitecat5
[2:12:09] broadcaster turbo GreatSphynx: thats a GONGO not a gongo
[2:12:17] vip premium plorf: MorshuRTX
[2:12:18] predictions subscriber JoGoBeans: catPls
[2:12:20] hexam_project: that's why i Kappa
[2:12:26] broadcaster turbo GreatSphynx: MiniK
[2:12:29] moderator founder turbo Dragoneye77: KappaPride
[2:12:31] predictions vip twitch-recap-2023 squirrelcabinet: ppL
[2:12:33] predictions superultracombo-2023 rattletrap69: Keepo
[2:12:39] vip premium plorf: catPls
[2:12:41] subscriber malty_meatia: HolidayCookie
[2:12:47] predictions Origfx: politics in my gongo smh my head 
[2:12:51] moderator founder turbo Dragoneye77: i hate that I own gongo now though 
[2:12:54] moderator founder turbo Dragoneye77: narry gave it to me 
[2:12:58] Artacus: GONGO 
[2:12:59] rplace-2023 ruxyy1337: the fun part is not the text but google rounds it up with a picture totally unrelated to it 
[2:12:59] moderator founder turbo Dragoneye77: in return I gave him gongo to 
[2:13:00] broadcaster turbo GreatSphynx: i still have never installed it 
[2:13:02] predictions subscriber twitch-recap-2023 n0tthedoctor: gongo
[2:13:05] predictions vip twitch-recap-2023 squirrelcabinet: D:
[2:13:06] predictions deworming_in_progress: ppL ppL ffzX
[2:13:09] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Gongo
[2:13:12] lintsock: gorgo 
[2:13:15] sub-gifter NastyRedX: Bitcoin miner probably LUL
[2:13:16] predictions subscriber twitch-recap-2023 Piyokopyo: bro your gongo hours 
[2:13:17] predictions vip twitch-recap-2023 squirrelcabinet: OYTrip
[2:13:20] predictions Origfx: OYTrip
[2:13:21] predictions subscriber snosa: OYOTrip
[2:13:21] predictions thedoodler303: OYTrip
[2:13:22] predictions subscriber twitch-recap-2023 Piyokopyo: greats8Ytrip
[2:13:22] predictions vip artist-badge Guardison: OYTrip
[2:13:22] premium cosmonaughtbob: OYTrip
[2:13:22] predictions sub-gift-leader divind95: OYTrip
[2:13:24] predictions subscriber JoGoBeans: OYTrip ... 
[2:13:24] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Ytrip
[2:13:25] predictions superultracombo-2023 rattletrap69: Gongo for thee, not for me? @GreatSphynx 9_9 
[2:13:25] predictions subscriber snosa: OYTrip ** 
[2:13:25] predictions subscriber premium neffpls: OYTrip
[2:13:26] Dust1210: OYTrip
[2:13:26] predictions vip rivrcom: goongle 
[2:13:27] broadcaster turbo GreatSphynx: so im gonna do a certain version of this cuz idk if i can handle the original 
[2:13:28] subscriber malty_meatia: greats8Ytrip
[2:13:29] predictions vip GodliestCat64: OYTrip
[2:13:31] subscriber sofasofia: greats8Ytrip
[2:13:33] xexsxexs: gongo
[2:13:33] predictions subscriber twitch-recap-2023 Piyokopyo: sweatFrog
[2:13:34] predictions subscriber partner Temiree: greats8Ytrip
[2:13:37] moderator founder turbo Dragoneye77: oh lord 
[2:13:38] predictions subscriber snosa: oh wow lol 
[2:13:38] predictions sub-gift-leader divind95: geez, it's that bad? 
[2:13:39] mick_sq: greats8Ytrip greats8YoTrip
[2:13:39] predictions Origfx: sweatFrogM
[2:13:39] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Gongo greats8Gongo greats8Gongo greats8Gongo greats8Gongo
[2:13:42] moderator founder turbo Dragoneye77: I have a bad feeling about this 
[2:13:42] predictions thedoodler303: monkaS
[2:13:47] twitch-recap-2023 WolfzenSkiigh: greats8YoTrip
[2:13:47] DaWhatTheFox: OYOTrip
[2:13:48] rplace-2023 ruxyy1337: ... of silence 
[2:13:49] premium cosmonaughtbob: greats8Ono
[2:13:49] predictions subscriber premium neffpls: chat im scared
[2:13:51] twitch-recap-2023 dringoose: greats8Ytrip greats8Ytrip greats8Ytrip greats8Ytrip greats8Ytrip greats8Ytrip greats8Ytrip
[2:13:53] vip premium plorf: sweatFrog
[2:13:53] predictions vip artist-badge Guardison: YES 
[2:13:53] premium cosmonaughtbob: MSTK3 
[2:13:55] dresden81: oh shit 
[2:13:55] predictions thedoodler303: LUL
[2:13:56] predictions sub-gift-leader divind95: MSTK3 
[2:13:57] terrancejones: Oh boy! 
[2:13:57] subscriber kakabookake: greats8YoTrip
[2:13:57] SushiGummy: monkaS
[2:14:00] predictions subscriber partner Temiree: greats8YoTrip
[2:14:02] Lastrin: MST3K! 
[2:14:03] predictions subscriber snosa: """""kids""""" 
[2:14:03] predictions sub-gift-leader divind95: OYOTrip
[2:14:03] predictions vip GodliestCat64: lmao 
[2:14:04] sub-gifter NastyRedX: greats8JAM
[2:14:06] predictions subscriber uchuu_elodie: ive seen this like 3 times over the last few days 
[2:14:06] predictions subscriber twitch-recap-2023 Piyokopyo: catPls work work work 
[2:14:06] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8YoTrip
[2:14:07] turbo nivis_shadoth: Yaaay! spynxHappi
[2:14:08] predictions subscriber JoGoBeans: catPls
[2:14:08] glitchcon2020 DeadheadJackal: If it's not Nestor The Christmas Donkey I'm painting the word poop on your wall--Oh god 
[2:14:11] subscriber malty_meatia: R. Weiner 
[2:14:11] predictions vip twitch-recap-2023 squirrelcabinet: sweatFrogM
[2:14:12] predictions Origfx: monkaS
[2:14:15] vip Babbott_Orion: Sadge 
[2:14:16] mick_sq: Yeat
[2:14:16] premium cosmonaughtbob: ALLAMARAINE
[2:14:21] vip uforgot: SPRIGGLE
[2:14:22] subscriber kakabookake: LUL
[2:14:23] predictions sub-gift-leader divind95: Santa isn't here daxMug
[2:14:23] broadcaster turbo GreatSphynx: sorry plorf 
[2:14:26] DaWhatTheFox: OYTrip
[2:14:29] rplace-2023 ruxyy1337: quarkYea a good step in the right direction 
[2:14:32] Artacus: annabelle monkaS
[2:14:33] vip premium plorf: at least its not rifftrax 
[2:14:37] Takamatsu2: rifftrax ? 
[2:14:39] vip premium plorf: dataBruh
[2:14:39] predictions vip artist-badge Guardison: lmao 
[2:14:40] broadcaster turbo GreatSphynx: it is 
[2:14:40] Blocknight1: monkaS
[2:14:41] moderator founder turbo Dragoneye77: lmao 
[2:14:42] predictions sub-gift-leader divind95: jesus christ 
[2:14:45] premium cosmonaughtbob: LUL
[2:14:45] predictions subscriber JoGoBeans: pogonaLUL
[2:14:46] subscriber twitch-recap-2023 carlysle_: LUL
[2:14:47] broadcaster turbo GreatSphynx: rifftrax and like late season mst3k are all t he same people 
[2:14:48] hexam_project: ??? 
[2:14:48] Weeyew: Yeah, Rifftrax. No seats. 
[2:14:48] subscriber malty_meatia: Lol 
[2:14:50] vip premium plorf: wait what 
[2:14:51] glitchcon2020 FlockOfToasters: LUL
[2:14:52] vip premium plorf: my mind is blown 
[2:14:58] SushiGummy: lol 
[2:15:07] predictions subscriber JoGoBeans: wait why are you apologizing for this 
[2:15:07] predictions sub-gift-leader divind95: tra la la la 
[2:15:09] moderator founder turbo Dragoneye77: they dont look like elves 
[2:15:13] moderator founder turbo Dragoneye77: they look like druids 
[2:15:15] premium cosmonaughtbob: Could they at least mic the kids LUL
[2:15:16] predictions subscriber snosa: ALLAMARAINE
[2:15:17] predictions subscriber partner Temiree: pretty mid tralalala yeah 
[2:15:20] hexam_project: is that table even fully painted? 
[2:15:21] predictions sub-gift-leader divind95: were you going to show this without the mstk3 commentary... zzooTrip
[2:15:25] subscriber malty_meatia: Near Impossible to decipher this audio 
[2:15:27] rplace-2023 ruxyy1337: LUL
[2:15:27] broadcaster turbo GreatSphynx: dragon this is a florida thing 
[2:15:33] moderator founder turbo Dragoneye77: oh god 
[2:15:37] premium cosmonaughtbob: greats8ZooTrip
[2:15:38] hexam_project: jfc of course it's a florida thing 
[2:15:41] vip premium artemis_dragmire: Oh we can blame Florida for this ok 
[2:15:43] subscriber malty_meatia: Santa got ran over by a reindeer 
[2:15:44] predictions thedoodler303: LUL
[2:15:45] predictions subscriber twitch-recap-2023 wallacewellactually: florida thing monkaS
[2:15:56] mick_sq: Sandta 
[2:15:56] hexam_project: jfc onc to be sure 
[2:15:56] predictions Origfx: zzooTrip
[2:15:57] superultracombo-2023 pjgrich: Bro's DRUNK 
[2:16:01] subscriber kakabookake: florida gongo
[2:16:03] Kestrel707: I thought sphynx was gongadian 
[2:16:04] moderator founder turbo Dragoneye77: tuvokHi IM COMING FOR YOU FAT MAN tuvokHi
[2:16:04] montrith: ooh this movie 
[2:16:07] predictions subscriber twitch-recap-2023 n0tthedoctor: @JoGo_ bc we almost didn't get the Rifftrax version 
[2:16:15] predictions Origfx: boots with the fur 
[2:16:16] moderator founder turbo Dragoneye77: argoKill KILL SANTA argoKill
[2:16:23] premium cosmonaughtbob: Mar-a-Lago greats8ZooTrip
[2:16:35] subscriber ferrio80: We got movie sign 
[2:16:35] predictions subscriber partner Temiree: djanoSweat
[2:16:35] subscriber malty_meatia: Go shirtless Santa 
[2:16:37] glitchcon2020 FlockOfToasters: ??? 
[2:16:38] predictions subscriber snosa: zzooTrip
[2:16:42] broadcaster turbo GreatSphynx: this isnt like overdrawn at the memory bank where its actually tolerable and fun without the commentary 
[2:16:44] vip twitch-recap-2023 viahate: zzooTrip
[2:16:44] broadcaster turbo GreatSphynx: this is just like 
[2:16:44] moderator founder turbo Dragoneye77: Hes going get naked 
[2:16:46] broadcaster turbo GreatSphynx: suffering without it 
[2:16:50] predictions subscriber snosa: lol 
[2:16:52] predictions sub-gift-leader divind95: lol 
[2:17:04] mick_sq: HahaLean sweaty 
[2:17:17] Blocknight1: owo is him 
[2:17:19] predictions thedoodler303: LUL
[2:17:21] islanduniverse87: OwO 
[2:17:22] predictions subscriber partner Temiree: owo is me 
[2:17:24] predictions subscriber snosa: owo 
[2:17:25] predictions sub-gift-leader divind95: WTFF
[2:17:26] predictions thedoodler303: OwO 
[2:17:27] subscriber sofasofia: owo 
[2:17:30] moderator founder turbo Dragoneye77: im going make a very specific reference only Flordians will understand 
[2:17:32] subscriber malty_meatia: UWU is me 
[2:17:32] premium cosmonaughtbob: 🎅 PianoTime
[2:17:33] dilly393: Is this the Thumbelina version or the Beanstalk version? 
[2:17:37] Blocknight1: LUL
[2:17:39] predictions subscriber twitch-recap-2023 n0tthedoctor: LUL
[2:17:39] moderator founder turbo Dragoneye77: Santa is going to The Villages 
[2:17:41] broadcaster turbo GreatSphynx: i think the thumbelina one 
[2:17:41] predictions thedoodler303: LUL
[2:17:53] predictions subscriber twitch-recap-2023 wallacewellactually: yeah it said thumbelina insert in the credits 
[2:18:00] Artacus: completely stuck 
[2:18:02] Artacus: so much sand 
[2:18:09] mick_sq: 999999 children should be getting this presents during all this time 
[2:18:13] predictions sub-gift-leader divind95: ok yeah i can see how draining this is without the commentary 
[2:18:15] mick_sq: their* 
[2:18:29] moderator founder turbo Dragoneye77: get down 
[2:18:32] predictions subscriber partner Temiree: ??? 
[2:18:32] predictions Origfx: HUHH
[2:18:33] premium cosmonaughtbob: LUL I did that as a kid 
[2:18:34] DaWhatTheFox: catJAMGF
[2:18:34] RDSk: Who are these commenting clowns 
[2:18:37] rplace-2023 ruxyy1337: shortytvOHNO
[2:18:39] glitchcon2020 FlockOfToasters: LUL
[2:18:44] predictions Origfx: real tragedy footage 
[2:18:45] moderator founder turbo Dragoneye77: this is sphynx and osmo 
[2:18:45] predictions thedoodler303: OwO is me 
[2:18:45] broadcaster turbo GreatSphynx: its me im doin g the commentary 
[2:18:46] predictions deworming_in_progress: @RDSk sphynx got a mic 
[2:18:46] dilly393: @RDSk the MST3K guys 
[2:18:46] moderator founder turbo Dragoneye77: theyre talking 
[2:18:48] predictions subscriber twitch-recap-2023 n0tthedoctor: OwO 
[2:18:50] predictions subscriber snosa: siskoPulp
[2:18:52] vip premium artemis_dragmire: !lazymoron 
[2:18:52] moderator partner Nightbot: https://i.imgur.com/aDoMOJZ.png 
[2:18:53] broadcaster turbo GreatSphynx: yeah and osmo 
[2:18:55] predictions subscriber snosa: thanks sphynx 
[2:18:56] predictions sub-gift-leader divind95: lmao 
[2:18:56] xexsxexs: gachiBASS
[2:18:58] predictions subscriber snosa: and omo 
[2:19:01] subscriber kakabookake: greats8Sping greats8Osmopat
[2:19:01] premium cosmonaughtbob: osmoD thanks osmo 
[2:19:04] predictions Origfx: LUL
[2:19:05] predictions subscriber twitch-recap-2023 wallacewellactually: talking osmo pog 
[2:19:12] mick_sq: Finally, voice reveal Kappa
[2:19:13] moderator founder turbo Dragoneye77: which one is osmo 
[2:19:17] islanduniverse87: typical Florida Christmas 
[2:19:19] moderator founder turbo Dragoneye77: !lazymoron 
[2:19:19] moderator partner Nightbot: https://i.imgur.com/aDoMOJZ.png 
[2:19:20] predictions thedoodler303: LUL
[2:19:28] predictions thedoodler303: This sucks so much 
[2:19:36] predictions subscriber snosa: dataSleep
[2:19:37] premium cosmonaughtbob: dataSleep
[2:19:37] predictions sub-gift-leader divind95: sleep of the sweaty 
[2:19:38] predictions Origfx: dataSleep
[2:19:41] xexsxexs: SCOTTY 
[2:19:43] Boscodbear: its xqc 
[2:19:44] predictions subscriber snosa: real snork mimimi 
[2:19:45] predictions thedoodler303: dataSleep
[2:19:50] Weeyew: Osmo has all the best jokes. 
[2:19:51] twitch-recap-2023 harryohead: dataSleep SnowTime 
[2:19:56] sylvaleaf: this is really something 
[2:19:57] Artacus: jmikeRunt
[2:19:59] moderator founder turbo Dragoneye77: legs broken 
[2:20:03] predictions subscriber twitch-recap-2023 n0tthedoctor: LUL
[2:20:07] dilly393: LUL
[2:20:10] predictions subscriber snosa: CatsJam
[2:20:10] Crunkerton: greats8Daxmug Answer the Call greats8Daxmug
[2:20:14] moderator founder turbo Dragoneye77: MIKE? 
[2:20:16] xexsxexs: bro you suck at skateboarding 
[2:20:18] DaWhatTheFox: TrumpetTime
[2:20:23] predictions Origfx: LUL
[2:20:25] superultracombo-2023 ririkosi: what 
[2:20:27] predictions subscriber twitch-recap-2023 n0tthedoctor: LUL LUL LUL
[2:20:30] subscriber kakabookake: okay LUL
[2:20:31] moderator founder turbo Dragoneye77: lmao 
[2:20:32] premium cosmonaughtbob: odokiss
[2:20:35] predictions thedoodler303: LUL
[2:20:35] vip afiddler: Santa and the Ice Cream Bunny? 
[2:20:36] rplace-2023 ruxyy1337: kirkTrip
[2:20:40] predictions sub-gift-leader divind95: pricemaster if santa 
[2:20:42] predictions subscriber snosa: kid 
[2:20:47] predictions subscriber twitch-recap-2023 n0tthedoctor: It took that long to end the fight LUL
[2:20:48] moderator founder turbo Dragoneye77: he really is going to the villages 
[2:20:59] predictions deworming_in_progress: why are they in a wasteland 
[2:20:59] mick_sq: @divind95 50000000 DOLLARS 
[2:21:09] moderator founder turbo Dragoneye77: this isnt a wasteland 
[2:21:09] predictions subscriber partner Temiree: @divind95 I fucking love Pricemaster LUL
[2:21:10] predictions Origfx: he was literally 100 meters from civilization 
[2:21:11] premium cosmonaughtbob: dataBye dataBye dataBye
[2:21:16] Blocknight1: monkaS
[2:21:17] moderator founder turbo Dragoneye77: this is Clermont 
[2:21:18] bits-charity illumination83: evilll 
[2:21:21] vip uforgot: PopNemo muahahahah 
[2:21:35] predictions subscriber twitch-recap-2023 n0tthedoctor: HahaDoge
[2:21:39] predictions subscriber partner Temiree: The one kid is running past the place where he jumped again 
[2:21:44] premium cosmonaughtbob: Luffy D:
[2:21:56] moderator founder turbo Dragoneye77: bruh 
[2:21:59] predictions Origfx: Som Tawyer 
[2:22:00] moderator founder turbo Dragoneye77: its literally tom sawyer 
[2:22:03] DaWhatTheFox: TrumpetTime 󠀀 
[2:22:04] predictions sub-gift-leader divind95: not the kazoo 
[2:22:04] predictions subscriber snosa: catPls
[2:22:09] predictions thedoodler303: catPls
[2:22:13] moderator founder turbo Dragoneye77: Wrong state wtf 
[2:22:18] premium cosmonaughtbob: @Dragoneye77 Literally Luffy LUL
[2:22:19] SoCosion: old man river? 
[2:22:20] predictions subscriber twitch-recap-2023 n0tthedoctor: Tom Sawyer 197X 
[2:22:21] islanduniverse87: Luffy 
[2:22:21] predictions Origfx: HUHH
[2:22:21] dilly393: One Piece live action remake looking good 
[2:22:23] DaWhatTheFox: raccoon pog 
[2:22:27] predictions subscriber partner Temiree: RaccAttack ??? 
[2:22:28] subscriber BingsF: RaccAttack
[2:22:31] predictions subscriber twitch-recap-2023 wallacewellactually: luffy d sawyer 
[2:22:32] predictions subscriber snosa: RaccAttack
[2:22:36] immunomics: That raccoon is not tame 
[2:22:36] predictions thedoodler303: @dilly393 jmikeKromegalul
[2:22:41] Blocknight1: imagine a rabid raccoon on a raft 
[2:22:42] mick_sq: Luffy is literally Tom Sawyer 
[2:22:45] Boscodbear: weird rush music video 
[2:22:59] sub-gifter NastyRedX: ok chat I got the $70 zelder for Christmas. should I finish botw before I start it 
[2:23:07] bits-charity illumination83: @Boscodbear lol 
[2:23:09] predictions Origfx: DOGE 
[2:23:12] moderator founder turbo Dragoneye77: oh god a pitbull 
[2:23:18] moderator founder turbo Dragoneye77: run santa 
[2:23:20] lintsock: KID OYOTrip
[2:23:20] subscriber malty_meatia: I went to go make peepee tinkle, what happened? 
[2:23:20] moderator founder turbo Dragoneye77: hes hungry 
[2:23:21] immunomics: Why so far away 
[2:23:31] dilly393: @NastyRedX how far in BOTW are you? 
[2:23:32] Crunkerton: @immunomics, For their safety 
[2:23:32] predictions Origfx: he's not moving his lips 
[2:23:34] predictions subscriber twitch-recap-2023 n0tthedoctor: Happy doggo 
[2:23:34] Bladestorm01: the pitbull named princess 
[2:23:35] vip premium artemis_dragmire: so santa can just summon children? 
[2:23:37] twitch-recap-2023 WolfzenSkiigh: @NastyRedX Yes ( Probably ) 
[2:23:37] rplace-2023 ruxyy1337: vineBunji1 vineBunji2
[2:23:37] predictions vip GodliestCat64: zzooTrip
[2:23:41] Bladestorm01: Kappa
[2:23:43] glitchcon2020 FlockOfToasters: monkaS
[2:23:46] moderator founder turbo Dragoneye77: but 
[2:23:46] predictions subscriber partner Temiree: "I lost my reindeer. You children are now my new reindeer." 
[2:23:49] moderator founder turbo Dragoneye77: Florida has deer 
[2:23:52] predictions deworming_in_progress: @NastyRedX not essential tbh 
[2:23:55] subscriber AgentAtaraxia: sphynxS
[2:23:58] bits LLugnuto779: @NastyRedX nah, you need to speedrun every zelda game first 
[2:24:05] Boscodbear: you can totally skip botw because there's barely any story 
[2:24:13] sub-gifter NastyRedX: @dilly393 uhhh I have one boss fight left I think 
[2:24:23] bits LLugnuto779: Pepechill DrumTime
[2:24:27] twitch-recap-2023 WolfzenSkiigh: D:
[2:24:27] moderator founder turbo Dragoneye77: lmao 
[2:24:28] predictions subscriber partner Temiree: D:
[2:24:29] broadcaster turbo GreatSphynx: iof youre in the middle of botw then just finish it cuz totk will make you not want to go back to it probably 
[2:24:30] predictions subscriber twitch-recap-2023 n0tthedoctor: LUL
[2:24:30] broadcaster turbo GreatSphynx: if its like 
[2:24:31] predictions sub-gift-leader divind95: what are these hats 
[2:24:32] predictions vip artist-badge Guardison: :Trkew 
[2:24:32] predictions deworming_in_progress: D:
[2:24:33] premium cosmonaughtbob: D:
[2:24:37] predictions vip artist-badge Guardison: damn it 
[2:24:37] broadcaster turbo GreatSphynx: you didnt finish it and you played it like years ago not recently 
[2:24:40] broadcaster turbo GreatSphynx: then yeah its fine to just start totk 
[2:24:41] Crunkerton: Suite Life of Zack and Cody 
[2:24:44] predictions subscriber partner Temiree: @divind95 bad ones 
[2:24:51] broadcaster turbo GreatSphynx: but if you were recently playing it you should prob just finish it idk
[2:24:54] predictions vip twitch-recap-2023 squirrelcabinet: Wowee
[2:25:03] predictions subscriber twitch-recap-2023 n0tthedoctor: LUL LUL
[2:25:06] montrith: Tom and Huck, the most unnecessary part of this movie where every part is uncessary 
[2:25:19] broadcaster turbo GreatSphynx: Spoik
[2:25:23] predictions vip artist-badge Guardison: holy fuck 
[2:25:25] Bladestorm01: the battle for home depot 
[2:25:26] immunomics: Spoik
[2:25:27] predictions subscriber snosa: tendiAAH
[2:25:30] moderator founder turbo Dragoneye77: its over 
[2:25:30] dilly393: D:
[2:25:31] twitch-recap-2023 WolfzenSkiigh: NotLikeThis
[2:25:32] predictions subscriber twitch-recap-2023 wallacewellactually: Spoik
[2:25:34] lintsock: Spoik
[2:25:43] predictions subscriber partner Temiree: BERMUS
[2:25:45] mick_sq: HUUH 
[2:25:48] predictions sub-gift-leader divind95: Spoik
[2:25:49] subscriber turbo puppetself: catBlink
[2:25:57] twitch-recap-2023 BeatDropGuy: LUL
[2:25:59] twitch-recap-2023 WolfzenSkiigh: Sternum destroying belt buckle 
[2:26:05] terrancejones: he speaks in wheezing 
[2:26:07] dilly393: @NastyRedX I'd probably try to beat it then 
[2:26:11] subscriber malty_meatia: Lol 
[2:26:31] predictions subscriber partner Temiree: me rn 
[2:26:34] premium cosmonaughtbob: Sphynx I got a new switch and tempted to complete BOTW which I last picked up 3 years ago. Im a very patient gamer 
[2:26:34] montrith: Yup Santa is definitely sweating, but imagine how bad the guy playing the Ice Cream Bunny smells in that costume. I mean, it's used EVERY DAY. 
[2:26:35] broadcaster turbo GreatSphynx: lol 
[2:26:37] predictions vip GodliestCat64: lmao 
[2:26:38] DaWhatTheFox: monkaSphynx
[2:26:38] predictions sub-gift-leader divind95: damn 
[2:26:39] dilly393: LUL
[2:26:39] predictions subscriber snosa: lol 
[2:26:41] vip twitch-recap-2023 viahate: lmao 
[2:26:42] mick_sq: LUL
[2:26:42] lintsock: WHAT
[2:26:45] moderator founder turbo Dragoneye77: ah yes 
[2:26:47] Bladestorm01: OMG 
[2:26:48] subscriber sofasofia: !! 
[2:26:50] moderator founder turbo Dragoneye77: so guys 
[2:26:51] predictions deworming_in_progress: its the spongebob gorilla 
[2:26:53] sub-gifter NastyRedX: thank you gongoloids greats8Froggy
[2:26:54] predictions sub-gift-leader divind95: zzooTrip
[2:26:54] moderator founder turbo Dragoneye77: this is a secret actually 
[2:26:57] moderator founder turbo Dragoneye77: Harambe didnt die 
[2:27:00] moderator founder turbo Dragoneye77: he moved to florida 
[2:27:02] lintsock: patrick? 
[2:27:03] moderator founder turbo Dragoneye77: dont tell anyone 
[2:27:04] predictions subscriber premium neffpls: NO VEY 
[2:27:05] dilly393: ah yes, the christmas gorilla. A Florida tradition 
[2:27:05] subscriber malty_meatia: Christmas Ape, Christmas Ape, here for Christmas cheeer 
[2:27:05] vip subscriber twitch-recap-2023 Whats_Aleppo: limesBlink
[2:27:08] predictions sub-gift-leader divind95: WTFF
[2:27:09] mick_sq: kirkBASS oooh oooh 
[2:27:12] premium cosmonaughtbob: Is this planet of the apes? 
[2:27:13] montrith: where did that kid find a gorilla 
[2:27:13] predictions subscriber snosa: o 
[2:27:28] moderator founder turbo Dragoneye77: that mule is actually fighting 
[2:27:33] montrith: Mule is smart enough not to want to be in the movie 
[2:27:33] predictions deworming_in_progress: poor donkey does not want to go 
[2:27:34] immunomics: Yes 
[2:27:37] predictions subscriber partner Temiree: I watched Trading Places yesterday I can't handle another gorilla suit 
[2:27:43] sub-gifter NastyRedX: I bought botw after it came out and then just didn't play it until like July of this year lol 
[2:27:57] Bladestorm01: NotLikeThis
[2:27:57] predictions sub-gift-leader divind95: -2 
[2:28:05] sub-gifter NastyRedX: everyone else already figured all that shit out LOL 
[2:28:25] predictions subscriber partner Temiree: get an alligator cowards 
[2:28:25] DaWhatTheFox: HOGGERS 
[2:28:26] moderator founder turbo Dragoneye77: monkaS
[2:28:27] moderator founder turbo Dragoneye77: NOOOO
[2:28:32] subscriber AgentAtaraxia: lmao 
[2:28:32] moderator founder turbo Dragoneye77: DANGER HOG 
[2:28:35] montrith: "All animals were harmed in the making of this movie" 
[2:28:36] predictions sub-gift-leader divind95: jfc how many live animals did they get this for 
[2:28:37] predictions subscriber snosa: rrrrrrrrrrrrrrrrr 
[2:28:40] predictions sub-gift-leader divind95: this hog does not look comfortable 
[2:28:42] mick_sq: 🐽 
[2:28:44] Bladestorm01: LUL
[2:28:45] subscriber malty_meatia: Christmas Pig, Christmas Pig, here for Christmas cheeeer! 
[2:28:47] dilly393: good thinking bringing Santa something to eat 
[2:28:48] predictions thedoodler303: LUL
[2:28:52] terrancejones: I hear the Tie fighter now 
[2:28:54] twitch-recap-2023 GigiWuzHere_: Dude don't mess with an angry pig 
[2:28:56] sylvaleaf: they should have used a live gorilla too 
[2:28:58] immunomics: Strap the raccoon up to the sleigh 
[2:28:59] predictions Origfx: odoNo poor livestock 
[2:29:03] moderator founder turbo Dragoneye77: this is just someones farm 
[2:29:03] dilly393: WutFace
[2:29:05] GUY_KAZAMA: DansGame
[2:29:17] mick_sq: Swamp Ass 
[2:29:18] moderator founder turbo Dragoneye77: dont do it chat 
[2:29:18] premium cosmonaughtbob: greats8ZooTrip
[2:29:20] subscriber malty_meatia: D:
[2:29:24] predictions thedoodler303: LUL
[2:29:25] Jairus: LUL
[2:29:27] predictions sub-gift-leader divind95: zzooTrip
[2:29:27] vip premium artemis_dragmire: SHEEP STUCK 
[2:29:28] dilly393: LUL
[2:29:29] twitch-recap-2023 WolfzenSkiigh: NotLikeThis
[2:29:31] predictions subscriber snosa: lol 
[2:29:33] predictions Origfx: BERMAN
[2:29:34] twitch-recap-2023 GigiWuzHere_: wideHUH
[2:29:39] predictions thedoodler303: BERMUS
[2:29:40] Bladestorm01: SHEEP STUCK PLS 
[2:29:44] twitch-recap-2023 GigiWuzHere_: .. 
[2:29:47] dilly393: D: poor sheep 
[2:29:52] subscriber malty_meatia: Kill him out back 
[2:29:58] moderator founder turbo Dragoneye77: i hope they get a gator 
[2:29:59] mick_sq: HahaLean Kill it 
[2:30:00] GUY_KAZAMA: odoCorn
[2:30:03] predictions subscriber partner Temiree: well that was all for mutton 
[2:30:05] moderator founder turbo Dragoneye77: god I hope they bring a gator 
[2:30:10] twitch-recap-2023 GigiWuzHere_: The kids during this: haha we're in danger 
[2:30:12] vip premium artemis_dragmire: @Dragoneye77 strap 2 gators to santa's sleigh and you have swamp santa 
[2:30:15] premium Zanclodon: it feels like these animals should have been in the opposite order 
[2:30:15] moderator founder turbo Dragoneye77: I will lose my shit if they bring a gator 
[2:30:17] vip premium moonshaped: i think these animals are like from the petting zoo or whatever from the park that funded this awful movie 
[2:30:22] predictions thedoodler303: @Temiree +2 
[2:30:31] predictions Origfx: @artemis_dragmire swampta 
[2:30:33] broadcaster turbo GreatSphynx: peglin plz 
[2:30:34] Bladestorm01: LUL
[2:30:39] predictions thedoodler303: LUL
[2:30:51] predictions subscriber partner Temiree: @thedoodler303 ty ty 
[2:30:54] predictions subscriber snosa: moo 
[2:30:57] moderator founder turbo Dragoneye77: moo 
[2:31:00] moderator founder turbo Dragoneye77: NOOO 
[2:31:01] predictions Origfx: NOOOO
[2:31:03] moderator founder turbo Dragoneye77: LEAVE THE COW ALONE 
[2:31:10] predictions subscriber snosa: honseWalk
[2:31:11] moderator founder turbo Dragoneye77: well this could work 
[2:31:15] predictions thedoodler303: honseSpin
[2:31:18] vip premium artemis_dragmire: honseWalk
[2:31:21] predictions subscriber partner Temiree: absolute unit 
[2:31:23] mick_sq: honseSpin
[2:31:24] twitch-recap-2023 WolfzenSkiigh: honseWalk
[2:31:24] lintsock: honseSpin
[2:31:30] predictions Origfx: casual horse-owning kid 
[2:31:36] Crunkerton: Alright, Horse. One clean kick and we can end this movie. 
[2:31:40] DaWhatTheFox: santa's gonna eat hoof 
[2:31:41] immunomics: A horse pulling a sleigh? Far fetched 
[2:31:43] dilly393: i hope these kids are all trained and licence animal handlers 
[2:31:50] moderator founder turbo Dragoneye77: backing a horse up is a pain in the ass 
[2:31:54] predictions Origfx: monkaS this is NOT safe 
[2:31:54] vip premium artemis_dragmire: What a good horse 
[2:31:58] moderator founder turbo Dragoneye77: horses can be stubborn as fuck 
[2:32:02] predictions deworming_in_progress: that horse had its ears pulled back monkaS
[2:32:06] Crunkerton: Walk directly behind the horse. It'll be fine 
[2:32:15] dilly393: yeah someone's getting kicked 
[2:32:18] vip premium artemis_dragmire: That is the most patient horse ever lol 
[2:32:26] Crunkerton: Biding its time 
[2:32:28] moderator founder turbo Dragoneye77: yeah this horse is actually kinda chill 
[2:32:28] predictions sub-gift-leader divind95: Uhhh
[2:32:29] predictions Origfx: same shot 
[2:32:44] broadcaster turbo GreatSphynx: osmo fell asleep on the towel i put on the floor to soak up the water he spilled 
[2:32:51] immunomics: Santa is incompetent 
[2:32:56] predictions subscriber partner Temiree: @GreatSphynx power move 
[2:32:56] moderator founder turbo Dragoneye77: if this horse wasnt comfortable he would have just walked off 
[2:33:01] mick_sq: Just have ALL the kids oull the sleigh towards the horse 
[2:33:01] twitch-recap-2023 WolfzenSkiigh: Osmo Sleepo
[2:33:02] Bladestorm01: osmoPats 
[2:33:06] subscriber malty_meatia: @greatsphynx UWU Omo osmoBlep
[2:33:10] twitch-recap-2023 GigiWuzHere_: osmoBlep soggy blanket 
[2:33:11] predictions thedoodler303: osmoPat
[2:33:12] sylvaleaf: water bed time 
[2:33:12] Crunkerton: He loves the sog 
[2:33:13] predictions subscriber snosa: osmoBlep
[2:33:13] glitchcon2020 DeadheadJackal: @GreatSphynx Soggy Boy 
[2:33:28] predictions deworming_in_progress: osmo is gonna sprout like beans in cotton balls 
[2:33:28] predictions subscriber twitch-recap-2023 n0tthedoctor: LUL
[2:33:33] moderator founder turbo Dragoneye77: santa be careful there might be needles 
[2:33:34] Weeyew: Soggy Osmo osmoPat
[2:33:40] twitch-recap-2023 GigiWuzHere_: How did he get there in the 1st place 
[2:33:50] predictions Origfx: low-effort santa 
[2:34:01] twitch-recap-2023 GigiWuzHere_: zzooTrip
[2:34:02] mick_sq: Wow Santa, you sure do suck! 
[2:34:04] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Bermus
[2:34:06] predictions subscriber JoGoBeans: guys it's hot in florida 
[2:34:08] predictions Origfx: Stare
[2:34:12] predictions sub-gift-leader divind95: none of htese kids are happy 
[2:34:12] premium cosmonaughtbob: greats8ZooTrip
[2:34:12] Boscodbear: @GigiWuzHere_ letting the day go by 
[2:34:14] moderator founder turbo Dragoneye77: that one kid doesnt want to be here 
[2:34:15] predictions subscriber partner Temiree: my face rn 
[2:34:15] moderator founder turbo Dragoneye77: at all 
[2:34:16] dilly393: that one kid does NOT want to be here LUL
[2:34:16] twitch-recap-2023 GigiWuzHere_: This is the worst camp ever 
[2:34:27] twitch-recap-2023 WolfzenSkiigh: These kids look miserable lmfao 
[2:34:29] predictions subscriber partner Temiree: @dilly393 she's done LUL
[2:34:55] Boscodbear: and santa was gormless 
[2:34:55] predictions subscriber partner Temiree: These kids were probably so excited to be in a movie 
[2:34:58] broadcaster turbo GreatSphynx: lol 
[2:35:02] predictions sub-gift-leader divind95: topical 
[2:35:02] twitch-recap-2023 GigiWuzHere_: Crosher
[2:35:03] sylvaleaf: I wonder how long those kids had to sit on that hot-ass beach filming this 
[2:35:05] Bladestorm01: LUL
[2:35:05] broadcaster turbo GreatSphynx: NYUMNYUMNYUM 
[2:35:07] subscriber twitch-recap-2023 carlysle_: LUL 󠀀 
[2:35:07] moderator founder turbo Dragoneye77: life day mentioned 
[2:35:13] mick_sq: Did we ever watch Thumbelina starring Carrie Fisher? 
[2:35:13] broadcaster turbo GreatSphynx: gordonDisgust
[2:35:13] twitch-recap-2023 WolfzenSkiigh: They LOVE sitting in 93 degree heat without shade and listening to a drawn out story 
[2:35:14] twitch-recap-2023 Merak_r: so true 
[2:35:15] predictions deworming_in_progress: that kid had shit on their chin 
[2:35:17] predictions sub-gift-leader divind95: catPls
[2:35:19] Bladestorm01: fucking life day 
[2:35:21] twitch-recap-2023 GigiWuzHere_: bruleWhere
[2:35:21] SushiGummy: catPls
[2:35:25] predictions Origfx: BERMAN movie picked up 
[2:35:25] glitchcon2020 DeadheadJackal: You think these kids ever saw a check from any of this 
[2:35:25] predictions subscriber partner Temiree: prawnzDance
[2:35:27] Boscodbear: atp0in20
[2:35:28] predictions subscriber snosa: catPls
[2:35:29] terrancejones: Tiptoe, through the tulips~ 
[2:35:34] twitch-recap-2023 WolfzenSkiigh: @DeadheadJackal God no 
[2:35:35] Jairus: catPls
[2:35:36] premium cosmonaughtbob: greats8JAM
[2:35:40] broadcaster turbo GreatSphynx: they probably got free admission to the park this was propaganda for 
[2:35:41] moderator founder turbo Dragoneye77: hmm 
[2:35:41] dilly393: Fun fact: This park closed the year after this was released 
[2:35:45] bits-charity illumination83: omg wth 
[2:35:47] predictions subscriber twitch-recap-2023 n0tthedoctor: LUL
[2:35:47] subscriber malty_meatia: greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE
[2:35:48] Bladestorm01: she's just walking away 
[2:35:51] premium cosmonaughtbob: LUL
[2:35:52] vip afiddler: catPls
[2:35:53] vip premium moonshaped: oh christ this part 
[2:35:57] immunomics: @deadheadjackal do you think literally anyone was paid anything beyond a cheese sandwich for the day's work 
[2:36:01] sylvaleaf: @DeadheadJackal I have doubts that the producers ever saw a check 
[2:36:02] twitch-recap-2023 WolfzenSkiigh: LMAO 
[2:36:06] broadcaster turbo GreatSphynx: catPls catPls catPls
[2:36:07] premium cosmonaughtbob: +2 
[2:36:08] predictions Origfx: catPls
[2:36:15] bits-charity illumination83: lol 
[2:36:16] subscriber sofasofia: catPls
[2:36:24] predictions subscriber partner Temiree: When was this filmed? 1970s? 
[2:36:26] vip premium plorf: zooTrip
[2:36:29] glitchcon2020 DeadheadJackal: Oh wait fuck I recognize that actress. The director also adapted a sequel to Wizard of Oz and she played one of the main characters. I remember now. 
[2:36:29] twitch-recap-2023 WolfzenSkiigh: that ride looks safe monkaS
[2:36:29] twitch-recap-2023 GigiWuzHere_: Safest amusement park ever \ :D / 
[2:36:31] mick_sq: This place looks like maximum safety hazard 
[2:36:31] predictions Origfx: that does NOT look safe 
[2:36:32] montrith: Santa isn't even telling them the story of Thumbelina, he's telling them the story of someone going to an amusement park and looking at Thumbelina themed dioramas 
[2:36:34] premium Zanclodon: this is all a result of leaded gasoline 
[2:36:35] predictions deworming_in_progress: that ride looks fun as fuck though 
[2:36:39] Boscodbear: action park 
[2:36:43] moderator founder turbo Dragoneye77: honestly safer than riding a real horse @WolfzenSkiigh 
[2:36:46] broadcaster turbo GreatSphynx: yeah like 72 
[2:36:51] predictions vip twitch-recap-2023 squirrelcabinet: buhCat
[2:36:58] twitch-recap-2023 GigiWuzHere_: Omg 
[2:37:00] subscriber sofasofia: horse... 
[2:37:14] predictions subscriber partner Temiree: With how low budget this is I was half expecting it to be 1992 lol 
[2:37:16] vera_azure: Rifftrax - Crimes of the Future (1970) 
[2:37:26] dilly393: the Thumbelina short was apparently 1970, the santa parts were 1972 
[2:37:29] bits-charity illumination83: lol 
[2:37:38] predictions subscriber JoGoBeans: what 
[2:37:39] vip afiddler: LUL
[2:37:42] subscriber malty_meatia: Lol 
[2:37:43] predictions subscriber snosa: lmao 
[2:37:44] bits-charity illumination83: played by zendaya 
[2:37:45] moderator founder turbo Dragoneye77: wait 
[2:37:45] predictions thedoodler303: LUL
[2:37:48] vip premium moonshaped: shay garner was in a tng ep i think 
[2:37:49] predictions subscriber partner Temiree: LUL
[2:37:50] vip premium artemis_dragmire: This is all crime scene 2 
[2:37:53] predictions subscriber twitch-recap-2023 Piyokopyo: serial killer photographs 
[2:37:55] predictions Origfx: HUHH
[2:37:56] predictions subscriber partner Temiree: D:
[2:37:57] predictions subscriber snosa: :0 
[2:38:02] vip premium moonshaped: that' slike her only other credi 
[2:38:05] Boscodbear: BOBBY MOYNIHAN 
[2:38:10] glitchcon2020 DeadheadJackal: Yeah this movie turns into Lord of the Flies in the third act 
[2:38:16] premium cosmonaughtbob: This must be a Rifftrax thing with Taylor Swift comments 
[2:38:16] predictions subscriber partner Temiree: wait this was the whole movie what the fuck? 
[2:38:21] twitch-recap-2023 GigiWuzHere_: bruleWhere
[2:38:22] predictions sub-gift-leader divind95: wideHUH
[2:38:25] predictions subscriber partner Temiree: Oh 
[2:38:34] vip premium artemis_dragmire: @Temiree we've started a new movie I think? 
[2:38:42] mick_sq: This place looks depressing 
[2:38:42] lintsock: grey leno??? 
[2:38:43] moderator founder turbo Dragoneye77: thats me 
[2:38:44] predictions Origfx: sounds like grey leno 
[2:38:51] predictions sub-gift-leader divind95: huh???? 
[2:38:52] DaWhatTheFox: wideHUH
[2:38:52] moderator founder turbo Dragoneye77: the others were osmo and sphynx 
[2:38:59] vip premium moonshaped: it's santa telling the kids on the beach a story about a girl at a park that goes into an exhibit of thumbelina and sees THIS story 
[2:39:02] twitch-recap-2023 GigiWuzHere_: Just adopt 
[2:39:07] montrith: Barry Mahon up there with other greats of cinema like Coleman Francis 
[2:39:09] vip premium artemis_dragmire: this has so many layers 
[2:39:10] vip premium moonshaped: it's very simple 
[2:39:19] predictions subscriber partner Temiree: @artemis_dragmire I'm not sure whether to be happy or annoyed about this temireEgg
[2:39:28] predictions Origfx: odoNo
[2:39:29] mick_sq: @moonshaped He's telling them about the movie about the girl seeing the exhibit about Thumbellina 
[2:39:32] subscriber malty_meatia: Truly, Surprised Italian Grandma's defining role 
[2:39:38] vip premium artemis_dragmire: the WITCH 
[2:39:39] Bladestorm01: santa is telling this shit 
[2:39:40] predictions sub-gift-leader divind95: The Vvitch 
[2:39:43] twitch-recap-2023 GigiWuzHere_: Uhhh
[2:39:48] premium X_eroz: Ahh yes, the witch. As you do 
[2:40:02] predictions Origfx: im so lost holy shit 
[2:40:04] twitch-recap-2023 GigiWuzHere_: Just casually seeing a witch 
[2:40:14] glitchcon2020 DeadheadJackal: Black Phillip will be here soon 
[2:40:19] vip premium artemis_dragmire: @GigiWuzHere_ Pretty standard florida moment 
[2:40:20] dilly393: This set is actually pretty neat for the budget 
[2:40:30] predictions Origfx: I just watched the VVitch yesterday holy shit LUL
[2:40:32] vip afiddler: There was also a Jack and the Beanstalk segment that was found and restored after this was taped. 
[2:40:50] predictions subscriber JoGoBeans: catPls
[2:40:52] twitch-recap-2023 GigiWuzHere_: catPls FluteTime
[2:40:52] moderator founder turbo Dragoneye77: greats8Bunji
[2:41:13] dilly393: so is Santa singing this song or is he telling the children the witch sang a song? 
[2:41:18] vip afiddler: catPls
[2:41:25] Bladestorm01: @dilly393 yes 
[2:41:44] vip premium artemis_dragmire: EEEEEE 
[2:42:15] broadcaster turbo GreatSphynx: dude idk wtf i did but i cleaned o ut my shower drain yesterday and now it drains worse than before i cleaned it out 
[2:42:17] moderator founder turbo Dragoneye77: holy fuck 
[2:42:22] immunomics: wait 
[2:42:23] broadcaster turbo GreatSphynx: and i put drain cleaner in it like 
[2:42:25] broadcaster turbo GreatSphynx: 3 times 
[2:42:29] moderator founder turbo Dragoneye77: im off until the 22nd of next month I just realized this lmao 
[2:42:29] immunomics: is this the rotten womb 
[2:42:29] predictions subscriber snosa: oh no 
[2:42:30] broadcaster turbo GreatSphynx: and it still drains like shit now lmao 
[2:42:33] glitchcon2020 DeadheadJackal: @GreatSphynx Ghost Hair 
[2:42:33] vera_azure: She should have gone to Raymond and Connie Marble instead. 
[2:42:33] vip afiddler: LUL
[2:42:35] moderator founder turbo Dragoneye77: sphynx we need to do stuff i have so much free time 
[2:42:39] predictions subscriber snosa: that's the fucking worst lol i'm sorry 
[2:42:57] twitch-recap-2023 WolfzenSkiigh: Haunted shower drain. Grudge confirmed 
[2:43:04] broadcaster turbo GreatSphynx: i gotta get out my makeshift compressed air plunger thing tomorrow 
[2:43:05] predictions deworming_in_progress: Uhhh ffzX
[2:43:15] montrith: 12 pennies is actually a really good rate, usually adoption costs much more 
[2:43:24] mick_sq: Did you used caustic soda? In my experience caustic soda works best, although it can leave a ahrd residue. 
[2:43:30] predictions subscriber partner Temiree: vineChatspin ster 
[2:43:31] Weeyew: Kids on the beach getting sunburned while Santa yaps on and on about some advertisement for the Pirates World theme park. 
[2:43:37] broadcaster turbo GreatSphynx: no i used some like commercial drain cleaner shit i had 
[2:43:42] broadcaster turbo GreatSphynx: let it sit for like 3 hours each time 
[2:43:45] premium FoxTenson: @GreatSphynx I used to be a plumber here. Don't put drain cleaner in! if this is a normal tub/shower take off the drain plate, stuff a wet towel/rag in it to make an air seal, then plunge the drain. Works like a dream 
[2:43:50] saxorlaud2: HUHH
[2:43:51] moderator founder turbo Dragoneye77: lmao oh my god 
[2:43:59] broadcaster turbo GreatSphynx: well 
[2:44:00] Jairus: LUL
[2:44:01] broadcaster turbo GreatSphynx: ill try that next 
[2:44:03] broadcaster turbo GreatSphynx: dataBruh
[2:44:17] predictions deworming_in_progress: !cum 
[2:44:17] moderator partner Nightbot: Roiker MilkTime BERMUS MilkTime Roiker MilkTime
[2:44:20] premium FoxTenson: Drain cleaner was made by plumbers for...plumbers! cause it'll wreck your shit, then we get to replace it for money! 
[2:44:25] premium AndroidPriest: ho ho and merry merry gongo enjoyers 
[2:44:28] broadcaster turbo GreatSphynx: NOOOO
[2:44:35] predictions subscriber snosa: merry merry 
[2:44:44] broadcaster turbo GreatSphynx: this stuff ive used before and its dissolved hair clogs but maybe its something else 
[2:44:52] broadcaster turbo GreatSphynx: its not the first time ive had to do this for this shower 
[2:44:53] Bladestorm01: Sponsor by BIG PLUMBING 
[2:45:04] moderator founder turbo Dragoneye77: is it solely the shower drain? 
[2:45:08] predictions subscriber JoGoBeans: Our tub drain gets clogged like every month and we've been pouring drain cleaner in there each time HUHH
[2:45:08] broadcaster turbo GreatSphynx: yeah 
[2:45:11] moderator founder turbo Dragoneye77: weird 
[2:45:23] premium FoxTenson: probably soap build up, that stuff ignores drain cleaner 
[2:45:24] broadcaster turbo GreatSphynx: last time i had to do it was like a yeaago-[ 
[2:45:29] moderator founder turbo Dragoneye77: Could ass Bass for an opinion 
[2:45:29] broadcaster turbo GreatSphynx: ['' 
[2:45:30] mick_sq: Might be worth trying soda. The kind you pour hot water on and it reacts like MAD 
[2:45:31] moderator founder turbo Dragoneye77: ask* 
[2:45:35] predictions subscriber JoGoBeans: osmoD
[2:45:36] predictions subscriber partner Temiree: big plumbing stopped us pooping outside for their own gain 
[2:45:37] predictions subscriber snosa: osmoStare
[2:45:37] moderator founder turbo Dragoneye77: he might know something 
[2:45:43] twitch-recap-2023 GigiWuzHere_: Akshually 
[2:45:47] dilly393: osmoD
[2:46:09] premium FoxTenson: pfft, nah itsactually more like, some places pushed chemicals. We always hated em 
[2:46:16] Crunkerton: You ever played I Have No Voice and I Must Scream? She sounds like the computer narrator in the yellow elevator. 
[2:46:22] premium FoxTenson: I was burned and hurt by drain cleaner waaaaaay too many times 
[2:46:25] vip premium artemis_dragmire: I'm more invested in sphynx's drain than I am with whatever the fu ck is happening in this movie 
[2:46:31] predictions subscriber snosa: yeah fr lol 
[2:46:36] immunomics: How tall are her fences 
[2:46:46] predictions subscriber partner Temiree: @artemis_dragmire it's a relatable story 
[2:46:49] subscriber malty_meatia: Sphynx, pull up drain cam 
[2:46:50] vip premium Monopool: sweatFrog
[2:46:50] broadcaster turbo GreatSphynx: zzooTrip
[2:46:51] predictions subscriber JoGoBeans: How long is this movie 
[2:46:52] twitch-recap-2023 WolfzenSkiigh: She lives in the Back Rooms 
[2:46:59] mick_sq: @FoxTenson SHit's no joke. Adviced to wear long sleeves and gloves while handling. 
[2:47:02] predictions subscriber twitch-recap-2023 Piyokopyo: ppL
[2:47:03] Jairus: LUL
[2:47:08] predictions subscriber snosa: drain plunging stream 
[2:47:31] broadcaster turbo GreatSphynx: i do have a snake too i think in the garage unless it got fucked up last time and i threw it away 
[2:47:46] premium FoxTenson: yeah like, I've run into snakes, gators, dead bodies, etc under buildings but drain cleaner? I'll steer clear of 
[2:47:47] broadcaster turbo GreatSphynx: but i have an air compressor in the garage and a like plunger attachment thing last time i used to clear some blockages 
[2:47:47] premium cosmonaughtbob: Downsizing 
[2:47:48] predictions subscriber JoGoBeans: holy shit are they gonna tell the entire story of Thumbellina and then finish up the Santa in Florida story? 
[2:47:57] twitch-recap-2023 Blank_Dogton: BERMAN minigirls 
[2:48:00] vip premium artemis_dragmire: lmao 
[2:48:03] mick_sq: We should send Thumbellina down Sphynx's drain and make her clean it. 
[2:48:06] twitch-recap-2023 GigiWuzHere_: Omg so realistic 
[2:48:08] broadcaster turbo GreatSphynx: dude good idea 
[2:48:12] broadcaster turbo GreatSphynx: someone get the jar 
[2:48:15] immunomics: What the duck was that ominous as shit shot 
[2:48:18] GUY_KAZAMA: it briefly turned into a futuristic dystopia 
[2:48:18] predictions subscriber snosa: lol 
[2:48:21] predictions thedoodler303: LUL
[2:48:25] premium FoxTenson: the air ram can work well for some things, but you still need to block off the emergency drain, which is usually where the tub plug plate is 
[2:48:25] premium AndroidPriest: "hi im thumbelina, and this is dirty jobs" 
[2:48:25] dilly393: LUL
[2:48:34] premium FoxTenson: no air seal and you are just farting in the wind 
[2:48:36] predictions sub-gift-leader divind95: damn what is this set 
[2:48:47] broadcaster turbo GreatSphynx: yeah i know i did it with mine last time 
[2:49:06] broadcaster turbo GreatSphynx: im not a plumber but i have enough understanding of physics to know to cover the backup drain lol 
[2:49:09] predictions subscriber partner Temiree: greats8Froggy
[2:49:09] twitch-recap-2023 GigiWuzHere_: WutFace
[2:49:12] subscriber malty_meatia: greats8Froggy
[2:49:14] twitch-recap-2023 Blank_Dogton: imagine someone grabbed her and put her in their mouth as a joke 
[2:49:15] vip Snudl: froggyFace
[2:49:16] dilly393: WutFace
[2:49:19] predictions deworming_in_progress: tendiAAH
[2:49:20] vip premium artemis_dragmire: this is one of the shittier frogs we've seen 
[2:49:20] predictions thedoodler303: froggyFace
[2:49:27] predictions subscriber partner Temiree: "I've been doing nuttin" 
[2:49:27] broadcaster turbo GreatSphynx: chuggagoon 
[2:49:29] premium AndroidPriest: leopard print frog 
[2:49:30] twitch-recap-2023 GigiWuzHere_: Omg 
[2:49:38] montrith: Deadbeat frog, get a jo! 
[2:49:40] subscriber turbo puppetself: CatDisplease
[2:49:41] montrith: job 
[2:49:42] premium FoxTenson: thats great! most people have no idea to do that and will spend hours plunging with no result 
[2:49:45] Jairus: HUH 
[2:49:49] dilly393: i looked away for like a second what happened 
[2:49:59] predictions subscriber snosa: weird frogs 
[2:50:00] twitch-recap-2023 GigiWuzHere_: noBrien
[2:50:04] broadcaster turbo GreatSphynx: my main issue is im just lazy not that i dont know how to fix stuff around my house 
[2:50:04] predictions sub-gift-leader divind95: we've lost santa awhiel ago 
[2:50:05] broadcaster turbo GreatSphynx: dataBruh
[2:50:13] predictions subscriber snosa: lol 
[2:50:39] broadcaster turbo GreatSphynx: i have a lot of stuff i gotta fix, i think is hould spend the next week or two getting my house in order for the new year 
[2:50:42] broadcaster turbo GreatSphynx: i probably said that last yeart 
[2:50:52] predictions subscriber JoGoBeans: oh fun fact, in Don Bluth's Thumbelina movie, Thumbelina gets kidnapped by Charo, the lady featured in the 1 hour Macarena video that we saw some time ago https://i.ytimg.com/vi/kJjFs_1IPhc/sddefault.jpg 
[2:50:54] premium FoxTenson: just remember if you use the air compressor, don't let people look in a drain 
[2:50:55] dilly393: WutFace
[2:50:57] twitch-recap-2023 WolfzenSkiigh: I feel it. wanna clean my place up to start the year better 
[2:50:58] twitch-recap-2023 GigiWuzHere_: ALLAMARAINE
[2:51:01] predictions subscriber snosa: WAAAAAAAAAAAAAAAAAA 
[2:51:02] twitch-recap-2023 GigiWuzHere_: tendiAAH
[2:51:05] broadcaster turbo GreatSphynx: i will tell osmo 
[2:51:06] Jairus: tendiAAH
[2:51:06] predictions thedoodler303: tendiAAH
[2:51:08] twitch-recap-2023 WolfzenSkiigh: WutFace
[2:51:13] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Ono
[2:51:14] predictions sub-gift-leader divind95: let osmo earn his keep 
[2:51:17] vip premium Monopool: you go that way, I'll go home 
[2:51:18] predictions Origfx: WutFace
[2:51:26] broadcaster turbo GreatSphynx: Uhhh
[2:51:26] predictions thedoodler303: LUL
[2:51:27] vip uforgot: tendiAAH pastaThat
[2:51:28] twitch-recap-2023 GigiWuzHere_: Osmo will help clear the drain 
[2:51:29] twitch-recap-2023 WolfzenSkiigh: LUL
[2:51:29] predictions subscriber twitch-recap-2023 Piyokopyo: NO 
[2:51:29] predictions subscriber snosa: yea i need to clean 
[2:51:30] predictions sub-gift-leader divind95: HUHH
[2:51:32] predictions subscriber snosa: declutter 
[2:51:32] vip premium Monopool: wideHUH
[2:51:32] montrith: why are they hopping 
[2:51:33] predictions subscriber JoGoBeans: they know about rule 34? OYOTrip
[2:51:33] premium AndroidPriest: @JoGo_ ive been thinking of this movie the whole time ive been here for this so far 
[2:51:37] HumeAndDoom: what 
[2:51:50] premium FoxTenson: we had some football manager lady not listen to us when we blew out a drainline with like 85lbs of force. We hit the line and heard a loud slap and her face was black with gunk 
[2:51:54] Crunkerton: pogonaWdang Me solemnly closing Clip Studio after being called out 
[2:51:56] predictions subscriber JoGoBeans: @AndroidPriest same because I saw the Thumbelina movie a shitload of times as a kid 
[2:52:00] broadcaster turbo GreatSphynx: spanX
[2:52:18] cheapsushidragon: duckDrop
[2:52:21] premium AndroidPriest: @JoGo_ same lol it was a fav. still love the art/animation 
[2:52:22] broadcaster turbo GreatSphynx: KILL HER 
[2:52:24] broadcaster turbo GreatSphynx: MASH HER 
[2:52:26] broadcaster turbo GreatSphynx: GET THE HAMMERS 
[2:52:29] predictions subscriber partner Temiree: @Crunkerton LUL
[2:52:29] lintsock: D:
[2:52:33] sylvaleaf: wow rude what the hell 
[2:52:35] HappyFeetTwoOnDVD: kenCosty
[2:52:35] mick_sq: D:
[2:52:35] predictions sub-gift-leader divind95: destroy daxKill
[2:52:37] twitch-recap-2023 WolfzenSkiigh: monkaS
[2:52:38] predictions subscriber snosa: SQUEEZE HER 
[2:52:40] predictions Origfx: monkaS
[2:52:43] premium AndroidPriest: BOIL HER MASH HER STICK HER IN A STEW 
[2:52:58] twitch-recap-2023 GigiWuzHere_: They went wild with the paper mache 
[2:53:21] twitch-recap-2023 GigiWuzHere_: dataSleep
[2:53:22] immunomics: The security of the tabletop literally lasted half a night 
[2:53:31] predictions vip artist-badge Guardison: feel like I'm watching a live action nanny lynn 
[2:53:37] predictions deworming_in_progress: @FoxTenson WorfCUM <-- like this 
[2:53:40] Bladestorm01: ASBESTOS monkaS
[2:53:42] twitch-recap-2023 GigiWuzHere_: Asbestos snow gerbPog SnowTime 
[2:53:49] DaWhatTheFox: yummy 
[2:53:52] predictions subscriber snosa: catPls FluteTime
[2:53:53] mick_sq: ALL the asbestos 
[2:53:56] vip premium Monopool: Nanny
[2:53:58] subscriber AgentAtaraxia: chewLes
[2:53:58] predictions subscriber twitch-recap-2023 Piyokopyo: Tasty mmm cancer 
[2:54:05] Bladestorm01: she died of Hypothermia 
[2:54:11] subscriber malty_meatia: Become Underdark dweller 
[2:54:11] predictions thedoodler303: LUL
[2:54:13] glitchcon2020 DeadheadJackal: Undertale... 
[2:54:15] dilly393: LUL
[2:54:22] twitch-recap-2023 GigiWuzHere_: Tasty SnowTime 
[2:54:26] premium AndroidPriest: lmao 
[2:54:26] vip premium plorf: sweatFrog
[2:54:30] predictions subscriber partner Temiree: It's asbestos they could do 
[2:54:33] broadcaster turbo GreatSphynx: osmo is back on the towel 
[2:54:36] broadcaster turbo GreatSphynx: dude has so many nice beds 
[2:54:38] predictions thedoodler303: @DeadheadJackal catPls Story of undertale catPls
[2:54:39] broadcaster turbo GreatSphynx: and a brand new tower 
[2:54:42] Bladestorm01: She became a Wendigo 
[2:54:44] broadcaster turbo GreatSphynx: and hes like yeah this wet towel is sick 
[2:54:49] broadcaster turbo GreatSphynx: on the floor 
[2:54:51] predictions subscriber snosa: lmfaooo 
[2:54:53] subscriber malty_meatia: It is the Osmo towel now 
[2:54:53] twitch-recap-2023 GigiWuzHere_: osmoD soggy towels 
[2:54:57] montrith: That be cats 
[2:55:06] predictions subscriber twitch-recap-2023 Piyokopyo: greats8YoTrip wet towels!!! 
[2:55:12] premium AndroidPriest: osmo's just a hoopy frood who always knows where his towel is 
[2:55:25] premium FoxTenson: @purahblubber2005 yeah but black! imagine a hot wet towel throw in your face with as much force as possible, except its green and black algae instead 
[2:55:31] Bladestorm01: this is the same set 
[2:55:35] predictions subscriber partner Temiree: $800 a night airbnb 
[2:55:40] mick_sq: A furry BERMAD
[2:55:47] predictions thedoodler303: @purahblubber2005 jmikeKromegalul
[2:56:01] vip premium Monopool: widepeepoSad wtf 
[2:56:05] Bladestorm01: D:
[2:56:07] predictions vip artist-badge Guardison: froggyFace wtf 
[2:56:17] dilly393: Sadge 
[2:56:20] Bladestorm01: race war... 
[2:56:31] broadcaster turbo GreatSphynx: wideHUH
[2:56:34] subscriber premium milesjacob: A KNIFE MAN? 
[2:56:40] predictions sub-gift-leader divind95: Uhhh
[2:56:40] Crunkerton: At least she's not a damn, god hating Pigeon 
[2:56:43] predictions subscriber partner Temiree: hyenaStaring
[2:56:43] predictions vip artist-badge Guardison: Uhhh
[2:56:55] twitch-recap-2023 GigiWuzHere_: Why is she talking to a black void 
[2:56:59] Rooks_Castle: Gonna be real with ya here chief, I thought I got hosted over to MST3K channel like 20 minutes ago 
[2:57:08] dilly393: this is a werid story 
[2:57:13] broadcaster turbo GreatSphynx: ;lmao rooks 
[2:57:14] predictions subscriber twitch-recap-2023 Piyokopyo: @Rooks_Castle lmao 
[2:57:16] bits-charity illumination83: literally old crow lol 
[2:57:16] predictions subscriber snosa: i like her skirt 
[2:57:17] subscriber malty_meatia: Grandma Sleep Paralysis Demon 
[2:57:21] Bladestorm01: Santa is saying rn 
[2:57:28] twitch-recap-2023 GigiWuzHere_: KaWutGuys
[2:57:34] vip premium artemis_dragmire: thanks nanny lynn speaker 
[2:57:46] broadcaster turbo GreatSphynx: oh wow it does sound like nanny lynn 
[2:57:51] premium AndroidPriest: Nanny
[2:58:03] predictions deworming_in_progress: jmikeRatgirl
[2:58:07] montrith: My favorite cinematic device in this movie is the shots of the loudspeaker, so we never forget this is just some girl looking at a diorama 
[2:58:23] premium AndroidPriest: this set somehow reminds me of kh wonderland 
[2:58:29] twitch-recap-2023 GigiWuzHere_: Beauty of paper mache 
[2:58:31] mick_sq: Remember Santa? 
[2:58:34] predictions subscriber JoGoBeans: Sleepo
[2:58:35] predictions vip artist-badge Guardison: fuck santa 
[2:58:41] predictions vip artist-badge Guardison: this is a mole girl movie now 
[2:58:50] predictions subscriber JoGoBeans: you get two movies in one chat don't complain RAGEY
[2:59:03] predictions vip artist-badge Guardison: sweatFrog
[2:59:11] twitch-recap-2023 GigiWuzHere_: Nobody's complaining 
[2:59:18] broadcaster turbo GreatSphynx: im complaining 
[2:59:31] predictions vip artist-badge Guardison: ALERTA
[2:59:33] mick_sq: They usually use "digga" among themselves instead. 
[2:59:33] vip premium moonshaped: here's the creepy mole 
[2:59:36] twitch-recap-2023 WolfzenSkiigh: RED FLAGS 
[2:59:37] predictions Origfx: monkaS
[2:59:37] vip Snudl: Uhhh
[2:59:38] subscriber robotsnake: ALERTA wideHUH ALERTA
[2:59:40] vip premium Monopool: ALERTA
[2:59:40] twitch-recap-2023 GigiWuzHere_: What are these blck voids??? 
[2:59:41] predictions deworming_in_progress: there is zero visible facial features on these creatures 
[2:59:42] vip premium moonshaped: he gives the grossest compliments 
[2:59:42] Bladestorm01: digger is there word 
[2:59:44] subscriber premium milesjacob: I AM VOID 
[2:59:44] predictions subscriber snosa: ALERTA
[2:59:44] Jairus: what a delicious looking child Tasty
[2:59:46] subscriber malty_meatia: The Perfect Child® julesj1Cat
[2:59:49] predictions sub-gift-leader divind95: um... 
[2:59:53] subscriber premium milesjacob: from which no light escapes 
[2:59:56] Jairus: HUHH
[2:59:57] twitch-recap-2023 GigiWuzHere_: bruleWhere
[3:00:01] sylvaleaf: do not go 
[3:00:03] premium AndroidPriest: revFear
[3:00:08] Jairus: wideHUH
[3:00:09] twitch-recap-2023 WolfzenSkiigh: monkaS
[3:00:10] subscriber robotsnake: LOL 
[3:00:15] twitch-recap-2023 GigiWuzHere_: kaceyUhOh
[3:00:16] predictions sub-gift-leader divind95: were* 
[3:00:16] moderator founder turbo Dragoneye77: so this is still the santa thing 
[3:00:20] predictions subscriber snosa: yes 
[3:00:20] predictions subscriber partner Temiree: hyenaStare
[3:00:23] predictions sub-gift-leader divind95: supposedly yes 
[3:00:34] predictions subscriber uchuu_elodie: yeah its santa telling the story of thumbelina to the kids on the beach 
[3:00:38] predictions subscriber twitch-recap-2023 Piyokopyo: i think they've lost the plot 
[3:00:38] Jairus: LUL
[3:00:41] twitch-recap-2023 WolfzenSkiigh: Meanwhile in the colon cave 
[3:00:41] subscriber malty_meatia: "We have such sights to show you..." 
[3:00:54] dilly393: Santa got heat stroke like 30 minutes ago 
[3:01:01] premium Zanclodon: the 500 foot rule doesnt apply if he lives under the school 
[3:01:12] twitch-recap-2023 GigiWuzHere_: wideHUH
[3:01:17] predictions subscriber partner Temiree: @Zanclodon LUL
[3:01:20] broadcaster turbo GreatSphynx: veryCat
[3:01:24] sylvaleaf: riiight I forgot about santa 
[3:01:25] moderator founder turbo Dragoneye77: its vinny 
[3:01:38] twitch-recap-2023 WolfzenSkiigh: That mole looking like a Fear and Hunger boss 
[3:01:52] mick_sq: D:
[3:01:55] dilly393: shnow 
[3:01:56] vip premium artemis_dragmire: schnofall 
[3:01:58] subscriber malty_meatia: @wolfzenskiigh Who says he isn't? 
[3:02:00] vip artist-badge Raxxmus: this looks like a TOS episode 
[3:02:03] predictions subscriber partner Temiree: WOW 
[3:02:04] moderator founder turbo Dragoneye77: the snow fall 
[3:02:04] twitch-recap-2023 WolfzenSkiigh: @malty_meatia monkaS
[3:02:05] predictions sub-gift-leader divind95: anyway, he's ugly so who cares 
[3:02:05] moderator founder turbo Dragoneye77: in Florida 
[3:02:10] moderator founder turbo Dragoneye77: the florida snowfall 
[3:02:22] predictions thedoodler303: @WolfzenSkiigh LUL
[3:02:27] dilly393: technically this is probably Denmark i guess? 
[3:02:30] mick_sq: No? 
[3:02:33] Crunkerton: @Dragoneye77 That's just the asbestos factories on fire 
[3:02:36] Jairus: this is where he kills her 
[3:02:41] predictions sub-gift-leader divind95: @WolfzenSkiigh bustin it down in mahabre 
[3:02:52] glitchcon2020 mprQQ: HUHH
[3:02:57] premium Zanclodon: he especially traveled to Thailand again and again 
[3:03:00] premium FoxTenson: Pre internet onlyfans sure is weird 
[3:03:05] twitch-recap-2023 GigiWuzHere_: All of it from Goodwill 
[3:03:13] glitchcon2020 DeadheadJackal: 🟥 🎏 
[3:03:15] montrith: It's very creepy how they keep referring to her as a child 
[3:03:29] vip uforgot: talkin' NY, I see 
[3:03:31] twitch-recap-2023 GigiWuzHere_: dataSleep
[3:03:40] dilly393: what was H C Andersen cooking with this? 
[3:03:41] broadcaster turbo GreatSphynx: yeah the whole thumbelina bit is creepy af 
[3:03:43] predictions sub-gift-leader divind95: why are all these animals lonesome 
[3:03:52] moderator founder turbo Dragoneye77: why isnt she wearing shoes 
[3:03:54] predictions subscriber snosa: sweatFrog
[3:03:58] vip premium moonshaped: he keeps calling her a child 
[3:04:04] broadcaster turbo GreatSphynx: she is a child 
[3:04:06] predictions subscriber JoGoBeans: ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA
[3:04:06] sylvaleaf: why doesn't he spend time with the nice widow next door instead of the actual child 
[3:04:09] vip premium artemis_dragmire: isn't she like 3 days old 
[3:04:13] Bladestorm01: HANS MOLEMAN MENTION 
[3:04:13] vip premium moonshaped: along with the gross compliments though 
[3:04:17] subscriber malty_meatia: Not Creepy© 
[3:04:18] predictions sub-gift-leader divind95: this feels creepy as hell 
[3:04:18] Crunkerton: "Wow, Mr. Mole, you got an awful lot of chains and ropes for someone without cattle" 
[3:04:35] predictions vip artist-badge Guardison: ALERTA
[3:04:35] moderator founder turbo Dragoneye77: stop 
[3:04:36] mick_sq: monkaS
[3:04:37] predictions subscriber JoGoBeans: ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA ALERTA
[3:04:38] twitch-recap-2023 GigiWuzHere_: kaceyUhOh
[3:04:39] predictions subscriber partner Temiree: ALERTA
[3:04:40] dilly393: ALERTA
[3:04:41] predictions subscriber snosa: Uhhh
[3:04:43] Bladestorm01: whoa 
[3:04:43] predictions vip artist-badge Guardison: ALERTA STOP ALERTA
[3:04:44] twitch-recap-2023 GigiWuzHere_: Girl run 
[3:04:47] SoCosion: ALERTA ALERTA ALERTA
[3:04:48] xx_noobslaya_xx: ALERTA
[3:04:50] predictions Origfx: froggyFace
[3:04:53] predictions deworming_in_progress: Uhhh ffzX Uhhh
[3:04:53] vip premium Monopool: froggyFace
[3:05:03] moderator founder turbo Dragoneye77: dataBruh
[3:05:05] broadcaster turbo GreatSphynx: spenX
[3:05:08] predictions Origfx: sweatFrog
[3:05:08] mick_sq: CEASE 
[3:05:10] subscriber malty_meatia: osmoStare
[3:05:11] dilly393: ALERTA
[3:05:11] Bladestorm01: STOP 
[3:05:13] twitch-recap-2023 WolfzenSkiigh: monkaS No don't 
[3:05:13] predictions thedoodler303: monkaS
[3:05:14] predictions subscriber twitch-recap-2023 Piyokopyo: sweatFrogM
[3:05:14] moderator founder turbo Dragoneye77: NO 
[3:05:15] predictions subscriber JoGoBeans: GET AWAY 
[3:05:15] twitch-recap-2023 Merak_r: good fuck 
[3:05:19] vip premium Monopool: sweatFrogM
[3:05:19] twitch-recap-2023 GigiWuzHere_: Run awayyy run awayyy run awayyy if you want to survive 
[3:05:20] predictions subscriber snosa: girl no 
[3:05:22] premium AndroidPriest: RUN THUMBELINA 
[3:05:24] predictions Origfx: how old is she supposed to be 
[3:05:25] broadcaster turbo GreatSphynx: so instead of taking you back to your mother i will marry you 
[3:05:27] moderator founder turbo Dragoneye77: worfLUL
[3:05:28] predictions thedoodler303: RUN 
[3:05:35] Bladestorm01: STEP AWAY FROM THE WOMAN 
[3:05:48] moderator founder turbo Dragoneye77: greats8Bunji
[3:05:50] subscriber malty_meatia: Kids on the beach shivering with fear and despair 
[3:05:52] twitch-recap-2023 WolfzenSkiigh: WHAT
[3:05:54] predictions sub-gift-leader divind95: ALERTA
[3:05:54] mick_sq: 🤨📸 
[3:05:55] predictions Origfx: sweatFrogM bring back florida santa 
[3:05:59] twitch-recap-2023 GigiWuzHere_: bruleWhere
[3:06:00] predictions subscriber partner Temiree: I can really feel the Christmas themes coming through in this movie 
[3:06:00] moderator founder turbo Dragoneye77: shut up 
[3:06:03] predictions vip artist-badge Guardison: ALERTA STOP ALERTA
[3:06:03] vip premium Monopool: 100% a fear and hunger boss 
[3:06:03] predictions sub-gift-leader divind95: "let me be you sugar daddy" 
[3:06:10] Bladestorm01: FBI OPEN UP 
[3:06:10] broadcaster turbo GreatSphynx: wideHUH
[3:06:11] moderator founder turbo Dragoneye77: kill the mole 
[3:06:14] predictions Origfx: WHAT
[3:06:14] predictions vip artist-badge Guardison: WHJAT 
[3:06:15] twitch-recap-2023 Merak_r: tendiAAH
[3:06:15] mick_sq: NO 
[3:06:16] twitch-recap-2023 GigiWuzHere_: ????? 
[3:06:16] Jairus: wideHUH
[3:06:17] predictions subscriber snosa: THINK AGAIN FREAK 
[3:06:18] predictions thedoodler303: OH GOD 
[3:06:20] moderator founder turbo Dragoneye77: HUHH
[3:06:27] twitch-recap-2023 WolfzenSkiigh: NotLikeThis
[3:06:29] predictions sub-gift-leader divind95: monkaS
[3:06:31] dilly393: WutFace
[3:06:40] predictions Origfx: reject humanity, become mole 
[3:06:42] moderator founder turbo Dragoneye77: wasnt there a corpse outside his house 
[3:06:47] ChrisGuerreroVA: jmikeCute
[3:06:50] twitch-recap-2023 GigiWuzHere_: Isn't Mrs mole his wife?? 
[3:06:52] glitchcon2020 DeadheadJackal: Truly this embodies the spirit of christmas 
[3:06:57] predictions vip artist-badge Guardison: why is santa telling this story 
[3:06:58] predictions Origfx: LUL
[3:07:12] vip premium artemis_dragmire: Santa's brain is shutting down from heat stroke 
[3:07:15] predictions Origfx: catJammingPolitely
[3:07:16] Bladestorm01: reminder: SANTA IS TELLING THIS
[3:07:17] mick_sq: Zoopederasty, my favorite for christmas. 
[3:07:18] twitch-recap-2023 WolfzenSkiigh: VOMIT NOW 
[3:07:20] vip Snudl: Those moles are funny though 
[3:07:21] Jairus: LUL
[3:07:23] twitch-recap-2023 GigiWuzHere_: That actor can't breathe in that costume 
[3:07:25] moderator founder turbo Dragoneye77: monkaS
[3:07:26] broadcaster turbo GreatSphynx: no way she didnt realize? 
[3:07:27] vip premium artemis_dragmire: back to nanny lynn 
[3:07:28] montrith: @GigiWuzHere_ No no, easy mistake to make, but this is Mr DIGGER, nor Mr Mole. 
[3:07:31] immunomics: Santa was actually the mole 
[3:07:36] premium AndroidPriest: the shots of the girl just observing all of this going on like daxMug
[3:07:43] predictions sub-gift-leader divind95: 'i don't want to marry frog so i will marry mole" 
[3:07:45] predictions subscriber JoGoBeans: hmmmMMMMMmmm 
[3:07:47] glitchcon2020 DeadheadJackal: That mole's name? Count Olaf 
[3:07:53] predictions vip artist-badge Guardison: I'm so fucking lost in the sauce 
[3:07:53] twitch-recap-2023 GigiWuzHere_: @montrith oh bruleWhere
[3:07:58] moderator founder turbo Dragoneye77: mister mole hates gilfs 
[3:07:58] predictions vip artist-badge Guardison: what the fuck is happening 
[3:08:02] subscriber malty_meatia: Harems have to start somewhere, I suppose 
[3:08:03] predictions Origfx: HUHH
[3:08:03] predictions subscriber snosa: zzooTrip
[3:08:08] mick_sq: Darn, I thought this Thumbellina thing was just gonna be a short 
[3:08:32] twitch-recap-2023 GigiWuzHere_: Kill them both and leave 
[3:08:37] broadcaster turbo GreatSphynx: this is so 70s 
[3:08:41] broadcaster turbo GreatSphynx: well 
[3:08:42] predictions vip artist-badge Guardison: TheVoices
[3:08:45] predictions Origfx: LuL
[3:08:45] broadcaster turbo GreatSphynx: and everything pre 70s 
[3:09:08] predictions sub-gift-leader divind95: is this a cult video 
[3:09:13] predictions subscriber snosa: yes 
[3:09:29] twitch-recap-2023 WolfzenSkiigh: monkaS Forever 
[3:09:37] predictions subscriber partner Temiree: @divind95 It was giving me those vibes too 
[3:10:01] predictions sub-gift-leader divind95: Would make sense for Florida 
[3:10:01] vip premium Monopool: free chicken dinner 
[3:10:19] twitch-recap-2023 GigiWuzHere_: wideHUH
[3:10:29] twitch-recap-2023 GigiWuzHere_: I think it's dead 
[3:10:42] dilly393: WutFace
[3:10:43] twitch-recap-2023 GigiWuzHere_: odoNo
[3:10:48] subscriber malty_meatia: Lol 
[3:10:49] predictions Origfx: sweatFrogM
[3:10:56] twitch-recap-2023 GigiWuzHere_: Why?? 
[3:10:56] vip premium artemis_dragmire: greats8Daxmug
[3:10:58] Bladestorm01: The zombie worm 
[3:11:06] premium AndroidPriest: the bird looking at the camera is so ominous 
[3:11:22] predictions vip artist-badge Guardison: stop 
[3:11:25] predictions subscriber snosa: odoAnguish
[3:11:25] machine_head: that is not a thing 
[3:11:27] premium LeBeauGringo: Guys i don't think that bird is real ... 
[3:11:30] broadcaster turbo GreatSphynx: lol 
[3:11:32] Bladestorm01: excuse me 
[3:11:34] dilly393: LUL
[3:11:35] predictions sub-gift-leader divind95: lol 
[3:11:36] twitch-recap-2023 GigiWuzHere_: Crosher
[3:11:38] moderator founder turbo Dragoneye77: she hates furries 
[3:11:51] lintsock: she doesn't want to fuck a mole? D:
[3:11:52] mick_sq: Don't have such high expectatives LUL
[3:11:56] predictions subscriber snosa: holy shit 
[3:12:04] vip premium artemis_dragmire: I thought the joke was the moles couldn't see her and thought she was a mole too 
[3:12:06] vip Snudl: Interspecies marriage is a minor inconvenience 
[3:12:07] predictions Origfx: mr dinker 
[3:12:09] subscriber premium milesjacob: I want to fuck young moles 
[3:12:10] vip premium artemis_dragmire: But apparently not what 
[3:12:15] moderator founder turbo Dragoneye77: oh
[3:12:16] predictions subscriber JoGoBeans: @Snudl odoKEK
[3:12:18] Crunkerton: This is all I am hearing: https://youtu.be/MajKccUpGiw?si=i-ac6kg30d8PQE5I&t=771 
[3:12:18] moderator founder turbo Dragoneye77: thats a good point artemis 
[3:12:20] moderator founder turbo Dragoneye77: lmao 
[3:12:28] premium FoxTenson: Is this the narrator from Fun in Balloon Land? 
[3:12:37] dilly393: @FoxTenson not drunk enough 
[3:13:05] vip premium moonshaped: no different narrator 
[3:13:07] premium FoxTenson: they sound exactly the same lol 
[3:13:15] montrith: Dumbass bird 
[3:13:21] vip premium moonshaped: that question would come up a lot in rifftrax chat 
[3:13:31] predictions vip artist-badge Guardison: zzooTrip
[3:13:36] twitch-recap-2023 WolfzenSkiigh: Those kids listening to Santa dying in the 98 degree heat by this point 
[3:13:43] predictions sub-gift-leader divind95: Uhhh
[3:13:43] premium FoxTenson: oh they watched that too? I saw it YEARS ago from cinema snob 
[3:13:52] premium FoxTenson: I gotta check out the rifftrax of it then 
[3:13:55] Crunkerton: Again, Santa 
[3:13:56] twitch-recap-2023 GigiWuzHere_: bruleWhere
[3:14:05] dilly393: @FoxTenson the Rifftrax version is very good 
[3:14:23] predictions sub-gift-leader divind95: oh her friend is gone 
[3:14:28] vip premium moonshaped: fun in balloonland used to get played for like 12 hours straight on holidays on the rt channel 
[3:14:32] premium FoxTenson: I know Brad was on rifftrax a few times so I gotta check that out too 
[3:14:37] broadcaster turbo GreatSphynx: fun in balloonland is brutal 
[3:14:43] vip premium moonshaped: at least the first couple years 
[3:14:47] vip premium moonshaped: i love it 
[3:15:07] twitch-recap-2023 GigiWuzHere_: My bird .. is gone. He has.. flown away 
[3:15:39] subscriber malty_meatia: Run, Thumbelina! Dingus! 
[3:15:40] moderator partner DesertP: zzooTrip
[3:15:43] broadcaster turbo GreatSphynx: zzooTrip
[3:15:55] predictions sub-gift-leader divind95: zzooTrip
[3:15:58] predictions vip artist-badge Guardison: zzooTrip where's santa 
[3:15:59] twitch-recap-2023 GigiWuzHere_: 🐦 
[3:16:00] dilly393: that costume looks super uncomfortable 
[3:16:00] predictions subscriber snosa: zzooTrip
[3:16:08] premium FoxTenson: rifftrax and cinema snob have introduced me to true horrors, Gongo many wonders 
[3:16:27] immunomics: I respect him too 
[3:16:44] broadcaster turbo GreatSphynx: spanXD
[3:16:45] predictions subscriber JoGoBeans: y'all gotta watch the Don Bluth Thumbelina movie at some point zzooTrip
[3:16:52] mick_sq: Is that a small eye on a white spot, or a big eye on a blue background? 
[3:16:53] moderator founder turbo Dragoneye77: i might end up in florida 
[3:17:00] twitch-recap-2023 GigiWuzHere_: spanXD
[3:17:01] moderator founder turbo Dragoneye77: a fate worse than death 
[3:17:13] Jairus: odoPain
[3:17:14] dilly393: @JoGo_ that's the one with the Gilbert Gottfried song right? 
[3:17:15] premium FoxTenson: why does the costume make it look like the dude is holding himself up with his arms 
[3:17:18] moderator partner DesertP: zzooTrip uuhh merry chrimstmas 
[3:17:35] moderator founder turbo Dragoneye77: desert what did you make your baldurs gate man 
[3:17:38] predictions subscriber JoGoBeans: I don't remember 
[3:17:39] predictions vip artist-badge Guardison: This bird sounds like off brand elijah wood 
[3:17:48] moderator partner DesertP: mine is a golden dragon man monk 
[3:17:57] moderator founder turbo Dragoneye77: monk dragon 
[3:17:58] moderator founder turbo Dragoneye77: monkey 
[3:17:59] predictions subscriber snosa: nice 
[3:18:02] dilly393: LUL
[3:18:04] Jairus: LUL
[3:18:06] moderator founder turbo Dragoneye77: i made a paladin half elf 
[3:18:11] cheapsushidragon: Falcor? 
[3:18:13] premium AndroidPriest: i havent played monk yet but it seems fun 
[3:18:16] subscriber malty_meatia: Very Real Flying™ 
[3:18:27] mick_sq: ?? 
[3:18:38] predictions subscriber snosa: i like unarmed classes 
[3:19:10] premium AndroidPriest: went w high elf paladin for my first playthrough, smite my beloved 
[3:19:14] premium FoxTenson: I have a dual wielding salami dude who also flings salami. Because why not 
[3:19:38] premium FoxTenson: I went with gnome, I think it was? Cause meat goblin 
[3:19:54] predictions sub-gift-leader divind95: whomst 
[3:20:00] broadcaster turbo GreatSphynx: wideHUH
[3:20:00] Bladestorm01: I learn Light Cleric can have Fireball LUL
[3:20:01] moderator founder turbo Dragoneye77: !cum 
[3:20:01] moderator partner Nightbot: Roiker MilkTime BERMUS MilkTime Roiker MilkTime
[3:20:03] twitch-recap-2023 Merak_r: he just made that up 
[3:20:04] vip twitch-recap-2023 viahate: LUL
[3:20:06] predictions vip artist-badge Guardison: zzooTrip
[3:20:06] dilly393: fucking AGAIN LUL
[3:20:08] predictions subscriber twitch-recap-2023 Piyokopyo: Uhhh
[3:20:08] vip premium artemis_dragmire: he says that to all the ladies 
[3:20:17] montrith: Everyone just wants to marry her after just meeting her 
[3:20:23] immunomics: Actual literal cult 
[3:20:29] vera_azure: She's holding out for Momotaro 
[3:20:36] dilly393: I never realizd that the Thumbelina story kinda sucks 
[3:20:45] dilly393: so I guess Thumbelinas mother got completely screwed then, great ending 
[3:20:52] twitch-recap-2023 GigiWuzHere_: They can all go on that show Land of the Giants 
[3:20:55] moderator founder turbo Dragoneye77: racism geneSad
[3:21:06] subscriber malty_meatia: She became a hippy :(
[3:21:15] subscriber hunnietoots: anakin? zzooTrip
[3:21:15] vip premium Monopool: Jebasted
[3:21:16] predictions subscriber snosa: yikes 
[3:21:20] sylvaleaf: no happy ever after for her mother I guess 
[3:21:34] twitch-recap-2023 GigiWuzHere_: I'm sorry but they look like Manson girls Crosher
[3:21:38] broadcaster turbo GreatSphynx: her mother wasnt young and attractive so she doesnt get a good ending 
[3:21:39] montrith: The lesson here is that racial mixing is wrong and we should all just stay with people who look like us. Probably not the INTENDED lesson, but that's what it sounds like. 
[3:21:44] twitch-recap-2023 GigiWuzHere_: I can't unsee 
[3:21:53] vip twitch-recap-2023 viahate: catPls
[3:21:57] twitch-recap-2023 GigiWuzHere_: kaceyScare
[3:22:01] mick_sq: *grins* 
[3:22:06] vip twitch-recap-2023 viahate: lmao 
[3:22:10] broadcaster turbo GreatSphynx: zzooTrip
[3:22:10] moderator founder turbo Dragoneye77: oh god 
[3:22:16] twitch-recap-2023 GigiWuzHere_: This needs to ens 
[3:22:17] moderator founder turbo Dragoneye77: they're in Broward 
[3:22:18] twitch-recap-2023 GigiWuzHere_: End 
[3:22:25] broadcaster turbo GreatSphynx: daxMug
[3:22:27] subscriber malty_meatia: :) :) :) :) :)
[3:22:31] predictions subscriber snosa: daxMug
[3:22:37] twitch-recap-2023 GigiWuzHere_: kaceyStare
[3:22:37] Bladestorm01: END TAPE 
[3:22:38] predictions vip artist-badge Guardison: jarJAM jarJAM
[3:22:47] moderator founder turbo Dragoneye77: so the santa plot still isnt done yet btw 
[3:22:47] glitchcon2020 DeadheadJackal: Santa has more horrors to teach you 
[3:22:55] mick_sq: If y'all wanna watch a much earlier (and far supperior) use of giant props to make someone look tiny, check out "The Incredible Shrinking Man" 
[3:22:55] ChrisGuerreroVA: jmikeRember
[3:22:58] moderator partner DesertP: i fell asleep but her awful singing woke me up 
[3:23:03] moderator founder turbo Dragoneye77: rip 
[3:23:05] predictions sub-gift-leader divind95: finally 
[3:23:05] predictions subscriber twitch-recap-2023 Piyokopyo: gumbelina 
[3:23:07] moderator founder turbo Dragoneye77: gongo curse 
[3:23:07] twitch-recap-2023 GigiWuzHere_: Crosher about time 
[3:23:07] subscriber robotsnake: WAYTOODANK
[3:23:09] moderator partner DesertP: GUMBELINA 
[3:23:17] predictions vip artist-badge Guardison: So are we going back to Santa 
[3:23:18] twitch-recap-2023 GigiWuzHere_: Lol they left 
[3:23:20] moderator founder turbo Dragoneye77: huh 
[3:23:24] vip premium artemis_dragmire: Mr Digger married Nanny lynn 
[3:23:25] vip Snudl: Uhhh
[3:23:35] predictions subscriber JoGoBeans: Next 2 hour story pls 
[3:23:37] twitch-recap-2023 GigiWuzHere_: spanXD
[3:23:46] poobus: are these the rocketeers? 
[3:23:47] predictions subscriber snosa: zzooTrip
[3:23:52] predictions sub-gift-leader divind95: LuL
[3:23:54] moderator founder turbo Dragoneye77: this was pirate worlds plan to counter Disney 
[3:23:58] moderator founder turbo Dragoneye77: it didnt work 
[3:24:08] twitch-recap-2023 Merak_r: what happened to Santa? 
[3:24:12] moderator founder turbo Dragoneye77: hes dead 
[3:24:13] twitch-recap-2023 Merak_r: oh
[3:24:15] predictions subscriber uchuu_elodie: he died 
[3:24:17] predictions vip artist-badge Guardison: oh okay 
[3:24:18] predictions thedoodler303: LUL
[3:24:18] predictions subscriber snosa: aw man 
[3:24:18] mick_sq: REMEMBER SANTA??? 
[3:24:19] moderator founder turbo Dragoneye77: wait 
[3:24:20] moderator founder turbo Dragoneye77: LOL 
[3:24:22] subscriber malty_meatia: plaC 
[3:24:25] moderator founder turbo Dragoneye77: Santa just forgotten 
[3:24:27] vip twitch-recap-2023 viahate: when does it end TheVoices
[3:24:30] predictions vip artist-badge Guardison: "Santa why did you get really detailed about that part with Mr Digger" 
[3:24:35] Bladestorm01: and back to the story 
[3:24:35] twitch-recap-2023 GigiWuzHere_: TheVoices
[3:24:35] poobus: Santa retired in Dania, FL THEEND 
[3:24:38] moderator founder turbo Dragoneye77: oh hes still alive 
[3:24:38] Crunkerton: They should all have been replaced with 30-year-olds with the same clothes 
[3:24:41] predictions deworming_in_progress: those kids have skin cancer now 
[3:25:10] moderator founder turbo Dragoneye77: dog named decimator of toddlers 
[3:25:13] twitch-recap-2023 GigiWuzHere_: Just get the kids to do it omg
[3:25:29] bits-charity illumination83: lol poor santa 
[3:25:34] twitch-recap-2023 GigiWuzHere_: Loool 
[3:25:35] predictions thedoodler303: LUL
[3:25:36] poobus: puppies are wonderful 
[3:25:51] predictions subscriber uchuu_elodie: this man is literally melting 
[3:25:51] predictions subscriber twitch-recap-2023 Piyokopyo: it's so H O T 
[3:25:57] vip twitch-recap-2023 viahate: monkaS
[3:25:58] dilly393: WutFace
[3:25:58] mick_sq: BERMUS
[3:25:59] twitch-recap-2023 WolfzenSkiigh: NotLikeThis
[3:25:59] twitch-recap-2023 GigiWuzHere_: kaceyUhOh
[3:26:02] predictions sub-gift-leader divind95: Uhhh
[3:26:02] GUY_KAZAMA: WutFace
[3:26:03] Bladestorm01: monkaS
[3:26:05] twitch-recap-2023 Merak_r: yikes 
[3:26:07] predictions subscriber twitch-recap-2023 Piyokopyo: ohh 
[3:26:09] bits-charity illumination83: yesss strip santa strip 
[3:26:14] superultracombo-2023 ultrahuhwhat: suns out guns out 
[3:26:15] poobus: he needs swimwear 
[3:26:19] grandfatigue: FeelsOkayMan
[3:26:21] twitch-recap-2023 Merak_r: finally 
[3:26:24] predictions deworming_in_progress: deadge 
[3:26:25] Bladestorm01: LUL
[3:26:26] predictions subscriber snosa: ty sun 
[3:26:27] bits-charity illumination83: Clap
[3:26:27] vip twitch-recap-2023 viahate: sun stroke LUL
[3:26:28] mick_sq: Real question is, why didn't he do that 2 hours ago? 
[3:26:29] twitch-recap-2023 GigiWuzHere_: ResidentSleeper
[3:26:40] dilly393: WutFace
[3:26:42] bits-charity illumination83: he livesss 
[3:26:44] Bladestorm01: WTF 
[3:26:45] twitch-recap-2023 GigiWuzHere_: ?¿?? 
[3:26:46] predictions subscriber snosa: what 
[3:26:46] vip twitch-recap-2023 viahate: ALERTA
[3:26:48] vip premium artemis_dragmire: This is just Santa's dying brain DMT trip 
[3:26:50] dilly393: ALERTA
[3:26:51] mick_sq: HUHH
[3:26:52] twitch-recap-2023 GigiWuzHere_: NO 
[3:26:52] bits-charity illumination83: his arch nemesis 
[3:26:55] predictions vip artist-badge Guardison: borf 
[3:26:57] GUY_KAZAMA: ALERTA
[3:26:58] predictions subscriber snosa: borf 
[3:26:58] poobus: his shift at the mall just ended 
[3:26:59] twitch-recap-2023 GigiWuzHere_: KaWutGuys
[3:27:02] twitch-recap-2023 WolfzenSkiigh: BARFK BARFK 
[3:27:08] predictions vip artist-badge Guardison: holy shit it wobbled 
[3:27:14] predictions subscriber partner Temiree: The warning sirens are going off. The bunny approaches. Run while you can. 
[3:27:17] twitch-recap-2023 WheresColonelPopcorn: deedledoop 
[3:27:19] twitch-recap-2023 WolfzenSkiigh: Nice coat hanger tires that thing has 
[3:27:20] dilly393: almost ran over the dog 
[3:27:26] bits-charity illumination83: lol 
[3:27:30] subscriber malty_meatia: Lol 
[3:27:30] twitch-recap-2023 GigiWuzHere_: Exactly the kind of bunny shit I was terrified of when I was a kid 
[3:27:31] predictions subscriber JoGoBeans: That shot was so fucking long 
[3:27:38] bits-charity illumination83: i saw dude hiding 
[3:27:39] vip premium Monopool: sweatFrog where did the dog go 
[3:27:42] twitch-recap-2023 GigiWuzHere_: Bunny suit 
[3:27:46] predictions subscriber snosa: zzooTrip
[3:27:53] DaWhatTheFox: this is a cursed video 
[3:27:53] twitch-recap-2023 WheresColonelPopcorn: I hope GTA VI is like this 
[3:27:57] twitch-recap-2023 GigiWuzHere_: ALERTA
[3:27:58] vip twitch-recap-2023 viahate: this is so unnerving OYTrip
[3:28:07] predictions subscriber partner Temiree: I can't believe they did this whole shot in one take. Inspirational filmmaking 
[3:28:12] predictions thedoodler303: LUL
[3:28:13] twitch-recap-2023 Merak_r: clocks ticking 
[3:28:13] predictions subscriber partner Temiree: oh nevermind 
[3:28:17] twitch-recap-2023 WolfzenSkiigh: monkaS
[3:28:19] dilly393: i have no idea how this didn't save Pirates World from bankrupcy 
[3:28:19] mick_sq: Is this Fortnite? 
[3:28:20] moderator founder turbo Dragoneye77: do you guys think this movie caused pirates world to go bankrupt 
[3:28:24] vip premium artemis_dragmire: why is the bunny's arrival heralded by a half dead tornado siren 
[3:28:26] moderator founder turbo Dragoneye77: the place shut down a year after this 
[3:28:28] twitch-recap-2023 GigiWuzHere_: Cameraman died 
[3:28:52] vip twitch-recap-2023 viahate: 🐰 SteerR
[3:28:54] predictions subscriber JoGoBeans: Accurate portrayal of RDR 2 main story mission pacing 
[3:28:55] mick_sq: AHHHHH 
[3:28:56] predictions subscriber snosa: lmfo 
[3:29:04] predictions vip artist-badge Guardison: Spoik
[3:29:06] poobus: Enricco Fetuccine 
[3:29:06] predictions subscriber snosa: terrifying 
[3:29:10] subscriber malty_meatia: ALERTA
[3:29:10] no_audio Tuxus11: why is that fraud of a bunny meeting with santa 
[3:29:11] moderator founder turbo Dragoneye77: woof 
[3:29:11] predictions thedoodler303: @JoGo_ LUL
[3:29:12] premium AndroidPriest: TheVoices make it fucking stop 
[3:29:12] predictions subscriber JoGoBeans: JFC 
[3:29:12] moderator partner DesertP: what the fuck is happening 
[3:29:13] twitch-recap-2023 GigiWuzHere_: Yes let the child control the out of control dog 
[3:29:14] twitch-recap-2023 Merak_r: weeeeewww 
[3:29:14] mick_sq: Why is the bunny horrible? 
[3:29:20] vip premium artemis_dragmire: Easter is here to wage war on santa 
[3:29:20] premium Zanclodon: dude is driving and has to see out that tiny mouth hole 
[3:29:20] moderator founder turbo Dragoneye77: @DesertP Gongo 
[3:29:25] montrith: @artemis_dragmire it indicates Silent Hill is now evil 
[3:29:29] moderator partner DesertP: LOL 
[3:29:36] ChrisGuerreroVA: jmikeTech
[3:29:48] moderator founder turbo Dragoneye77: nice plastic belt 
[3:29:55] vip twitch-recap-2023 viahate: jfc end the scene already TheVoices
[3:29:58] vip Snudl: ALERTA TheVoices ALERTA
[3:29:58] predictions subscriber twitch-recap-2023 Piyokopyo: catPls oh woe is me 
[3:30:05] twitch-recap-2023 GigiWuzHere_: Crosher
[3:30:06] predictions subscriber snosa: ALERTA ALERTA ALERTA ALERTA ALERTA
[3:30:14] moderator founder turbo Dragoneye77: argoKill GOD IS COMING argoKill
[3:30:16] predictions thedoodler303: ITS SO SLOW jmikeKromegalul
[3:30:17] DaWhatTheFox: ALERTA catJAM
[3:30:18] predictions thedoodler303: WHY 
[3:30:21] mick_sq: Unfathomably cursed. hitMe
[3:30:23] twitch-recap-2023 GigiWuzHere_: ALERTA
[3:30:25] vip premium Monopool: ALERTA GET TO THE SHELTER 
[3:30:29] superultracombo-2023 ultrahuhwhat: ALERTA
[3:30:30] dilly393: ALERTA
[3:30:30] predictions subscriber snosa: weoooooooooooo 
[3:30:32] twitch-recap-2023 GigiWuzHere_: NUKE INCOMING 
[3:30:40] subscriber malty_meatia: My mind is going. I'm a...fraid 
[3:30:42] twitch-recap-2023 Merak_r: TheVoices
[3:30:43] lintsock: ALERTA
[3:30:46] twitch-recap-2023 GigiWuzHere_: ALERTA ALLAMARAINE
[3:30:46] Bladestorm01: GERMAN AIR RAID 
[3:30:49] moderator founder turbo Dragoneye77: wait 
[3:30:50] twitch-recap-2023 zipp_leafeon: TheVoices
[3:30:50] dilly393: it's amazing that this was not supposed to be horrifying 
[3:30:52] CarrotCube: i thought the movie ended like 4 scenes ago 
[3:30:55] moderator founder turbo Dragoneye77: yeah where did fake tom sawyer go 
[3:31:00] premium Zanclodon: a kid fell off 
[3:31:01] twitch-recap-2023 WolfzenSkiigh: Easter(?) Bunny has launched a nuke 
[3:31:26] mick_sq: CRASH 
[3:31:32] twitch-recap-2023 GigiWuzHere_: NUKE coming right for Santa 
[3:31:34] subscriber malty_meatia: Lol 
[3:31:36] twitch-recap-2023 Merak_r: lmao 
[3:31:37] predictions subscriber snosa: Explosion
[3:31:39] predictions thedoodler303: LUL
[3:31:43] predictions subscriber snosa: hiii 
[3:31:45] twitch-recap-2023 GigiWuzHere_: WutFace
[3:32:10] vera_azure: usmari1Slither
[3:32:27] bits-charity illumination83: poor doog 
[3:32:31] predictions Origfx: WutFace
[3:32:31] predictions subscriber snosa: it''s so scary 
[3:32:33] twitch-recap-2023 GigiWuzHere_: Omg it's terrifying 
[3:32:38] bits-charity illumination83: lolll 
[3:32:38] twitch-recap-2023 GigiWuzHere_: kaceyScare
[3:32:39] premium AndroidPriest: its fucking awful 
[3:32:40] Weeyew: Yeat
[3:32:41] turbo Fhuey: WutFace
[3:32:44] moderator founder turbo Dragoneye77: the dude in the bunny suit is literally dying 
[3:32:47] mick_sq: Yeat
[3:32:48] twitch-recap-2023 GigiWuzHere_: That dog hates it 
[3:32:50] premium AndroidPriest: the dog is UPSET 
[3:32:50] twitch-recap-2023 WheresColonelPopcorn: Dog is not happy 
[3:32:56] predictions subscriber snosa: Yeat
[3:32:57] subscriber malty_meatia: Poor dog 
[3:33:03] GUY_KAZAMA: Yeat
[3:33:04] twitch-recap-2023 GigiWuzHere_: Yeat OhMyDog
[3:33:14] deepspacejani: at first i thought i was watchingRifftrax LUL
[3:33:20] twitch-recap-2023 GigiWuzHere_: Why must it wink??? 
[3:33:21] deepspacejani: i was like wtf 
[3:33:23] bits-charity illumination83: lolll 
[3:33:26] twitch-recap-2023 WheresColonelPopcorn: LUL
[3:33:46] broadcaster turbo GreatSphynx: lol 
[3:33:54] predictions thedoodler303: catPls
[3:33:55] vip twitch-recap-2023 viahate: catPls
[3:33:56] predictions subscriber twitch-recap-2023 Piyokopyo: jarJAM
[3:33:58] mick_sq: Drummin' her little head 
[3:34:00] subscriber malty_meatia: Ha ha ha hahahhaa 
[3:34:03] twitch-recap-2023 GigiWuzHere_: kaceyScare
[3:34:08] twitch-recap-2023 WolfzenSkiigh: NotLikeThis
[3:34:11] predictions Origfx: he's making it WORSE 
[3:34:18] twitch-recap-2023 WheresColonelPopcorn: heh heh heheeeh 
[3:34:21] twitch-recap-2023 GigiWuzHere_: Stop winking!! 
[3:34:21] premium FoxTenson: So when does the Angry Video Game Nerd fly in to suplex the bunny? 
[3:34:44] twitch-recap-2023 GigiWuzHere_: Leaving the kids?? 
[3:34:46] Crunkerton: Back wheels spattering the kids with wet sand 
[3:34:53] subscriber malty_meatia: @foxtenson He was too afraid to approach this scene 
[3:34:59] predictions Origfx: TREKW get fucked 
[3:35:08] broadcaster turbo GreatSphynx: wideHUH
[3:35:16] dilly393: look at the kind trying to restrainthe dog 
[3:35:19] subscriber malty_meatia: HUHH
[3:35:22] dilly393: kid* 
[3:35:25] twitch-recap-2023 WolfzenSkiigh: ^ about to eat shit in the sand 
[3:35:26] twitch-recap-2023 GigiWuzHere_: Left them odoKEK
[3:35:31] twitch-recap-2023 WheresColonelPopcorn: that dog was out for blood after all that 
[3:36:07] twitch-recap-2023 GigiWuzHere_: Lord of the flies time 
[3:36:12] sub-gifter NastyRedX: OH GOD ITS STILL GOING 
[3:36:15] Jairus: LUL
[3:36:16] moderator founder turbo Dragoneye77: huh 
[3:36:18] predictions thedoodler303: @GigiWuzHere_ jmikeSoypog
[3:36:25] twitch-recap-2023 GigiWuzHere_: PauseChamp 
[3:36:30] Jairus: catPls
[3:36:31] moderator founder turbo Dragoneye77: thank god its over 
[3:36:33] predictions sub-gift-leader divind95: oof 
[3:36:35] predictions subscriber premium neffpls: IT'S FINALLY OVER 
[3:36:35] subscriber malty_meatia: That hurt 
[3:36:35] predictions deworming_in_progress: thank GOD 
[3:36:35] predictions sub-gift-leader divind95: that was rough 
[3:36:36] broadcaster turbo GreatSphynx: sorry about that 
[3:36:37] predictions vip artist-badge Guardison: Clap I am in hell 
[3:36:37] twitch-recap-2023 WheresColonelPopcorn: Jesus Christ what a mess 
[3:36:38] twitch-recap-2023 Merak_r: that was 
[3:36:38] broadcaster turbo GreatSphynx: !break 
[3:36:38] predictions subscriber snosa: odoNo Clap
[3:36:38] moderator partner Nightbot: It's time for a break, don't go away. 3min of ads will play so you don't have to see any ads for the next hour. Otherwise chill and enjoy the music. 
[3:36:38] DaWhatTheFox: Clap
[3:36:39] mick_sq: That was VERYdifficult to watch 
[3:36:40] cheapsushidragon: STOPTAPE
[3:36:42] broadcaster turbo GreatSphynx: ill do something good next 
[3:36:43] predictions deworming_in_progress: Clap
[3:36:43] twitch-recap-2023 GigiWuzHere_: Crosher Clap
[3:36:44] subscriber twitch-recap-2023 ocarina_boy: that was terrible thanks Clap
[3:36:44] dilly393: that was brutal Clap
[3:36:44] predictions thedoodler303: Clap
[3:36:45] twitch-recap-2023 WolfzenSkiigh: Clap Holy moly that was. Something. 
[3:36:45] premium AndroidPriest: Clap freedom 
[3:36:46] Jairus: odoPain Clap
[3:36:47] predictions subscriber twitch-recap-2023 Piyokopyo: Sludge not forgiven 
[3:36:49] predictions subscriber snosa: ty sphynx 
[3:36:51] twitch-recap-2023 WheresColonelPopcorn: I appreciate the mindfuck 
[3:36:54] predictions subscriber JoGoBeans: beep boop? 
[3:37:00] predictions vip artist-badge Guardison: catJAMGF
[3:37:01] moderator partner DesertP: BERMAN something good? 
[3:37:03] cheapsushidragon: wideVIBE
[3:37:04] vip premium Monopool: catPls
[3:37:04] premium Zanclodon: cinema peaked in 1972 
[3:37:07] predictions subscriber twitch-recap-2023 Piyokopyo: GettingJiggyWithIt
[3:37:09] predictions subscriber snosa: catJammingPolitely
[3:37:11] subscriber malty_meatia: catJammingPolitely
[3:37:13] predictions sub-gift-leader divind95: beep boop cleanse catJammingPolitely
[3:37:16] twitch-recap-2023 GigiWuzHere_: Imagine watching that without the rifftrax commentary 
[3:37:20] vera_azure: That was WONDERFUL greats8PEPPERONI_SG
[3:37:24] twitch-recap-2023 GigiWuzHere_: dataSleep
[3:37:27] predictions thedoodler303: catJAMM
[3:37:27] twitch-recap-2023 WolfzenSkiigh: Chat if you ever feel insecure about your own writing, remember that toxic dump of a film somehow got made 
[3:37:28] predictions Origfx: sphynx you need to heal us after that 
[3:37:48] moderator partner DesertP: if you ever feel insecure about your writing at least you put thought into it unlike someone who used chatgpt 
[3:37:50] grandfatigue: catJammingPolitely
[3:37:53] predictions sparquah: Get Up by The Blow is a great song 
[3:37:59] predictions sparquah: such a mood 
[3:38:10] mick_sq: DinoDance mikePls
[3:38:12] twitch-recap-2023 WolfzenSkiigh: Based Desert lmfao 
[3:38:17] twitch-recap-2023 GigiWuzHere_: I don't write cause that is a story I would come up with 
[3:38:26] whisperstatic: limesDance starBlob limesDance
[3:38:27] twitchcon2018 Taizun: Is this a song about that Titan submersible? 
[3:38:33] twitchcon2017 RossTB: chatGPT creates better star trek plots than nutrek 
[3:38:35] broadcaster turbo GreatSphynx: yeah 
[3:38:38] bits-charity illumination83: ALLAMARAINE
[3:38:50] grandfatigue: noBrien
[3:39:01] moderator founder turbo Dragoneye77: i was really disappointed when I found this kinda furniture crafting channel cause the content seemed interesting 
[3:39:04] twitch-recap-2023 GigiWuzHere_: ResidentSleeper ✏️ 🗒️ 
[3:39:07] bits-charity illumination83: burkeWaddle
[3:39:09] moderator founder turbo Dragoneye77: but half the guys video is using AI stuff 
[3:39:16] whisperstatic: Sphynx do you have a public playlist for all the gongo music 
[3:39:27] moderator founder turbo Dragoneye77: i dont know why a furniture maker would need to even use chatgpt for a video lmao 
[3:39:30] broadcaster turbo GreatSphynx: !playlist 
[3:39:30] moderator partner Nightbot: Spooty playlist of music from the stream: https://open.spotify.com/playlist/7FmvSjvbSviRWgLACnP9yt YouTube playlist: https://youtube.com/playlist?list=PL28y8g5R15Wp60snlRsQkCcEGzu7eDJU5 
[3:39:31] broadcaster turbo GreatSphynx: yeah 
[3:39:36] broadcaster turbo GreatSphynx: i sometimes forget to add stuff but 
[3:39:39] broadcaster turbo GreatSphynx: between these two its like 90% 
[3:39:40] whisperstatic: limesOmg
[3:40:13] vip uforgot: atamStare
[3:40:15] poobus: is this the ganguro fan club? 
[3:40:17] broadcaster turbo GreatSphynx: spotify list is like mostly like copyright music 
[3:40:23] broadcaster turbo GreatSphynx: lots of youtube is like 
[3:40:27] subscriber twitch-recap-2023 ocarina_boy: catJAMPARTY
[3:40:29] twitchcon2018 Taizun: catPls
[3:40:31] predictions subscriber snosa: catJammingPolitely
[3:40:31] broadcaster turbo GreatSphynx: old stuff or like less popular stuff or library music 
[3:40:35] broadcaster turbo GreatSphynx: but its spread between both 
[3:40:36] predictions thedoodler303: catJAMPARTY
[3:40:37] vip uforgot: atamJam
[3:40:41] broadcaster turbo GreatSphynx: so i guess spotify is my more normie playlist 
[3:40:51] vip uforgot: atamBop DrumTime
[3:40:54] subscriber malty_meatia: Yeat Yeat Yeat
[3:41:19] subscriber twitch-recap-2023 ocarina_boy: GettingJiggyWithIt
[3:41:25] vip twitch-recap-2023 viahate: Funnywhitecat5 Funnywhitecat5 Funnywhitecat5
[3:41:38] poobus: gotta imagine sounds for the "osmo meeping around" playlist 
[3:42:11] broadcaster turbo GreatSphynx: ive played music around osmo since i got him and put streams on and stuff constantly so he doesnt really get bothered when i listen to music loud or watch stuff 
[3:42:21] broadcaster turbo GreatSphynx: sometimes he goes in the other room and watches whatever stream i left on in my bedroom by himself 
[3:42:34] predictions subscriber snosa: WatchingStream
[3:42:41] moderator partner DesertP: its good to get your animals accustomed to music 
[3:42:43] woodybasket: catJAMM HYPERDRUMTIME
[3:42:57] broadcaster turbo GreatSphynx: i listen to music all the time so it would be bad if it scared him 
[3:43:19] poobus: hehe yeah I have a kitty that is perfectly calm and happy if I leave cartoons on for her while i'm out of the house 
[3:43:49] predictions subscriber snosa: o SHIT 
[3:43:49] moderator partner DesertP: OYOTrip
[3:43:50] predictions sub-gift-leader divind95: this song lmao 
[3:43:51] subscriber twitch-recap-2023 ocarina_boy: catJAM
[3:43:51] subscriber dumbmoths: holy 
[3:43:52] predictions Origfx: catJAM
[3:43:52] DaWhatTheFox: catJamrgb catJamrgb
[3:43:53] predictions subscriber snosa: catJAM
[3:43:54] predictions thedoodler303: catPls
[3:43:55] subscriber malty_meatia: Ay ee ay ee ayyy 
[3:43:55] subscriber robotsnake: OH SHIT lacPls sarueiCheer
[3:43:56] moderator partner DesertP: pogonaRave
[3:43:56] vip uforgot: SMILE D.K 
[3:43:58] predictions thedoodler303: catJAM
[3:43:59] predictions sub-gift-leader divind95: catJAM
[3:43:59] premium Iceckryss: catJAM
[3:44:01] subscriber twitch-recap-2023 ocarina_boy: catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM
[3:44:01] twitch-recap-2023 WolfzenSkiigh: greats8YoTrip It's been 83 years 
[3:44:02] premium FoxTenson: my legs started DDRing 
[3:44:03] predictions subscriber snosa: catPls catPls catPls catPls catPls catPls catPls
[3:44:04] bits-charity illumination83: FeelsBadMan
[3:44:04] CarrotCube: catJam catPls catJam catPls
[3:44:04] predictions thetwitch3r: catJAM
[3:44:04] vip truthandpenitence: lmo 
[3:44:05] predictions subscriber premium neffpls: catJAM
[3:44:05] vip uforgot: WHY DO I KNOW THIS
[3:44:05] woodybasket: meowJAMJAM
[3:44:06] twitchcon2018 Taizun: cirRave
[3:44:06] twitch-recap-2023 WolfzenSkiigh: DinoDance
[3:44:08] subscriber malty_meatia: NESSIE NESSIE NESSIE
[3:44:08] subscriber hypn0toad5: catJAM
[3:44:09] vip truthandpenitence: lmao rather 
[3:44:10] premium AndroidPriest: quarkDance the memories that just unlocked 
[3:44:11] subscriber dumbmoths: catJAM catJAM catJAM
[3:44:12] poobus: I play music most of the time, I think my cats think something's up if it was quiet 
[3:44:13] Jairus: catPls
[3:44:14] DaWhatTheFox: ratJAM Yeat catJamrgb funnywhitecat5
[3:44:14] mick_sq: Cheap toy phone moosic 
[3:44:15] predictions subscriber snosa: UWU
[3:44:16] premium FoxTenson: go go DDR 
[3:44:18] moderator partner DesertP: this was the song that got me into ddr at one point 
[3:44:19] Rooks_Castle: catPls
[3:44:19] vip uforgot: atamAYAYA atamAYAYA atamAYAYA
[3:44:20] predictions thedoodler303: catJAM I'm your little butterfly catJAM
[3:44:20] LeefSnake: GettingJiggyWithIt
[3:44:21] premium Tac_Kilala: vineKermiepls vineKermiepls vineKermiepls vineKermiepls vineKermiepls
[3:44:21] broadcaster turbo GreatSphynx: CatApple CatApple CatApple 
[3:44:22] hexam_project: oh from DDR 
[3:44:25] moderator founder turbo Dragoneye77: yeah this is ddr 
[3:44:25] predictions subscriber snosa: catPls catPls catPls catPls catPls catPls
[3:44:26] hexam_project: right? 
[3:44:28] vip premium plorf: funnywhitecat5
[3:44:30] broadcaster turbo GreatSphynx: yeah this was in the very first ddr game 
[3:44:34] hexam_project: yep 
[3:44:37] broadcaster turbo GreatSphynx: and was like probably the most popular song in it 
[3:44:38] premium AndroidPriest: this was one of THE ddr songs, like, everyone pulled it up all the time 
[3:44:39] hexam_project: i played that 
[3:44:45] predictions vip twitch-recap-2023 squirrelcabinet: Funnywhitecat5
[3:44:45] vip Snudl: CatApple Wawa CatApple Wawa CatApple Wawa CatApple 
[3:44:47] predictions subscriber snosa: high humble heels..... 
[3:44:48] twitch-recap-2023 Merak_r: NESSIE NESSIE NESSIE NESSIE NESSIE
[3:44:48] vip uforgot: I do have a butterfly freestyle routine online. Somewhere. 
[3:44:52] no_audio Tuxus11: this is that one song that always played in cheap plastic toy cellphones 
[3:45:03] premium FoxTenson: I still got those games! If my back wasn't bad now I'd get back into it 
[3:45:04] mick_sq: quarkPls quarkDance quarkPls quarkDance quarkPls
[3:45:06] DaWhatTheFox: catJAMGF catJAMGF catJAMGF
[3:45:12] broadcaster turbo GreatSphynx: this, boom boom dollar, and be my lover were the ones i always liked 
[3:45:13] subscriber malty_meatia: greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE
[3:45:15] premium nickynack: NESSIE
[3:45:16] vip premium plorf: catJAM
[3:45:16] broadcaster turbo GreatSphynx: and any of the paranoia songs 
[3:45:22] vip premium plorf: i love barbie girl by aqua 
[3:45:23] premium Tac_Kilala: jmikeSquandance vineKermiepls jmikeSquandance vineKermiepls jmikeSquandance
[3:45:40] predictions vip twitch-recap-2023 squirrelcabinet: meowJAMJAM
[3:45:40] poobus: afronova 
[3:45:41] mr_ski_: @GreatSphynx max 300 
[3:45:47] vip uforgot: @GreatSphynx ah, you two are a man of culture 
[3:45:52] moderator partner DesertP: i saw the barbie movie it was actually really fucking funny 
[3:45:56] poobus: it only takes a minute(to fall in love!) 
[3:45:57] predictions thedoodler303: jmikeSquandance heartwoodDance catPls jmikeSquandance heartwoodDance catPls jmikeSquandance heartwoodDance catPls jmikeSquandance heartwoodDance catPls
[3:45:58] broadcaster turbo GreatSphynx: tbh for early bemani games though i liked the songs beatmania had a lot more than ddr 
[3:45:59] moderator partner DesertP: it was kind of like a really meta clueless 
[3:46:03] broadcaster turbo GreatSphynx: but i was into both 
[3:46:03] mr_ski_: B A G 
[3:46:04] RohanFalcon: I cannot hear this song without the Jack Black version singing of an octagon. 
[3:46:23] predictions Origfx: wait isnt this a die antwoord song too 
[3:46:24] vip premium plorf: i rewatched barbie with my aunt the other night 
[3:46:26] vip premium plorf: fun movie 
[3:46:32] mick_sq: "IS THAT JAR JAR BINKS??" 
[3:46:42] poobus: had a 4th mix ddr machine in my local mall I was happy to waste my hot topic wages on 
[3:46:44] predictions thedoodler303: OYTrip
[3:46:44] premium Tac_Kilala: DDR was such a vibe 
[3:46:44] hexam_project: two songs i liked as a kid was witch doctor and the safety dance 
[3:46:46] predictions sub-gift-leader divind95: OYTrip
[3:46:46] twitch-recap-2023 WolfzenSkiigh: Clap nostalgia jam 
[3:46:48] DaWhatTheFox: OYTrip
[3:46:48] predictions subscriber snosa: OYTrip
[3:46:51] predictions subscriber twitch-recap-2023 Piyokopyo: greats8Ytrip
[3:46:52] vip uforgot: and then guitarfreaks/drummania is the other thing they do 
[3:46:52] subscriber malty_meatia: OYTrip
[3:46:53] premium nickynack: OYTrip
[3:46:56] predictions subscriber snosa: i had ddr extreme 2 for ps2 lol 
[3:46:56] moderator partner DesertP: greats8Ytrip
[3:46:57] twitch-recap-2023 Merak_r: OYOTrip
[3:46:58] predictions subscriber snosa: OYOTrip
[3:46:58] predictions subscriber twitch-recap-2023 Piyokopyo: catJAM
[3:46:59] twitch-recap-2023 WolfzenSkiigh: greats8YoTrip
[3:46:59] predictions thetwitch3r: OYOTrip
[3:47:00] subscriber robotsnake: FUCK YES 
[3:47:00] premium FoxTenson: Move your feet was the other one I remember a lot 
[3:47:00] DaWhatTheFox: OYOTrip
[3:47:01] predictions subscriber JoGoBeans: BEEP BOOP 
[3:47:01] vip premium plorf: OYOTrip
[3:47:01] Blocknight1: OYOTrip
[3:47:01] vip uforgot: atamAYAYA
[3:47:02] predictions thedoodler303: OYOTrip bebop 
[3:47:02] superultracombo-2023 pjgrich: FYEAAAAAA 
[3:47:03] predictions sub-gift-leader divind95: aw damn im gonna miss bebop 
[3:47:03] predictions vip artist-badge Guardison: catJAM
[3:47:03] vip twitch-recap-2023 viahate: catJAM catJAM catJAM catJAM
[3:47:03] premium nickynack: OYOTrip yeeeeeee 
[3:47:04] Takamatsu2: PogChamp
[3:47:04] subscriber twitch-recap-2023 ocarina_boy: catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM
[3:47:05] moderator partner DesertP: oh ok 
[3:47:05] DaWhatTheFox: catJAM catJAM catJAM
[3:47:06] moderator partner DesertP: damn 
[3:47:06] subscriber dumbmoths: holy shit 
[3:47:07] moderator founder turbo Dragoneye77: chat rewarded 
[3:47:08] premium AndroidPriest: oh shittttt OYOTrip
[3:47:09] subscriber malty_meatia: Wawa Wawa Wawa Wawa Wawa
[3:47:09] predictions subscriber snosa: catJAM catJAM catJAM catJAM catJAM catJAM catJAM
[3:47:09] predictions thetwitch3r: catJAM
[3:47:10] predictions thedoodler303: Lets jam 
[3:47:11] vip Snudl: catJAM TrumpetTime
[3:47:11] premium nickynack: catJAM
[3:47:11] grandfatigue: catJAM
[3:47:12] dresden81: catJAM
[3:47:12] premium Tac_Kilala: HELLO KomodoHype
[3:47:13] predictions thedoodler303: catJAM
[3:47:13] bits-charity illumination83: burkeWaddle burkeWaddle burkeWaddle burkeWaddle
[3:47:15] subscriber hypn0toad5: oh fuck yeah let's go 
[3:47:16] twitch-recap-2023 WolfzenSkiigh: catJAM
[3:47:16] Blocknight1: oof late bebop 
[3:47:17] subscriber KatalepsyKills: catJAM
[3:47:17] predictions Origfx: ONOTrip holy SHIT 
[3:47:18] woodybasket: catJAMM SaxTime
[3:47:19] vip uforgot: kirkBASS TrumpetTime
[3:47:22] grandfatigue: Wawa
[3:47:23] predictions subscriber snosa: funnywhitecat5
[3:47:23] poobus: dat handsome devil 
[3:47:27] RohanFalcon: The secret Christmas present of coming to Gongo at this specific time. 
[3:47:28] premium AndroidPriest: GettingJiggyWithIt
[3:47:29] Bladestorm01: DinoDance DinoDance DinoDance DinoDance
[3:47:31] predictions sub-gift-leader divind95: gotta get to bed, but have fun with faye odoAWOOGA
[3:47:32] predictions subscriber JoGoBeans: catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM
[3:47:33] predictions subscriber snosa: wideVIBE
[3:47:34] premium Tac_Kilala: TwitchConHYPE TwitchConHYPE TwitchConHYPE
[3:47:36] subscriber dumbmoths: catJAM
[3:47:40] DaWhatTheFox: AlienDance
[3:47:41] moderator founder turbo Dragoneye77: sweden 
[3:47:43] moderator founder turbo Dragoneye77: and or ukraine 
[3:47:51] predictions subscriber snosa: AlienDance
[3:47:53] vip afiddler: ratJAM
[3:47:54] vip premium plorf: catPls
[3:47:55] woodybasket: catJAM
[3:47:59] predictions vip artist-badge Guardison: did you get a different rip of it or was I just not paying attention to how high def iw as last time 
[3:48:06] broadcaster turbo GreatSphynx: nope same rip 
[3:48:09] broadcaster turbo GreatSphynx: its the blu ray rescan 
[3:48:10] poobus: Finland is where it's at now 
[3:48:11] hexam_project: it was hd last time 
[3:48:12] predictions subscriber JoGoBeans: catJAM TrumpetTime
[3:48:13] premium nickynack: catJAM
[3:48:17] predictions subscriber snosa: catJAM
[3:48:19] DaWhatTheFox: catJAMPARTY
[3:48:42] predictions subscriber snosa: ughhh it looks so good 
[3:48:47] moderator founder turbo Dragoneye77: planet gongo
[3:48:49] subscriber malty_meatia: Surprise, it's Bladerunner 
[3:48:54] predictions subscriber JoGoBeans: good episode 
[3:48:54] predictions vip artist-badge Guardison: odoAWOOGA
[3:48:56] premium Tac_Kilala: I can’t believe this anime came out in 98, it’s aged like fine wine 
[3:48:58] mick_sq: legga 
[3:48:59] twitch-recap-2023 Merak_r: BERMAN
[3:48:59] broadcaster turbo GreatSphynx: i just wish the volume wasnt so low 
[3:48:59] predictions sub-gift-leader divind95: she is her odoAWOOGA
[3:49:00] predictions subscriber snosa: :o
[3:49:00] DaWhatTheFox: 🥃 
[3:49:04] broadcaster turbo GreatSphynx: i boosted it too 
[3:49:06] broadcaster turbo GreatSphynx: and its still low 
[3:49:07] broadcaster turbo GreatSphynx: idk why 
[3:49:08] predictions Origfx: BERMAN
[3:49:14] predictions thedoodler303: BERMAN
[3:49:15] moderator partner DesertP: sounds fine to me 
[3:49:22] bits-charity illumination83: she has a wedgie 
[3:49:22] predictions vip artist-badge Guardison: sounds fine yeah 
[3:49:30] moderator founder turbo Dragoneye77: man he called her a hoor 
[3:49:32] broadcaster turbo GreatSphynx: yeah i guess sound wise its actually fine im just so used to the meter 
[3:49:37] predictions vip twitch-recap-2023 squirrelcabinet: catBoom
[3:49:39] Takamatsu2: miss every shot ? 
[3:49:41] moderator founder turbo Dragoneye77: great clip right there 
[3:49:42] woodybasket: KKona Clap
[3:49:46] broadcaster turbo GreatSphynx: and i also keep my reference volume lower than actual 1:1 because i dont want it to be too loud for osmo 
[3:49:54] predictions deworming_in_progress: NOOOO MY CUM JARS 
[3:49:54] Bladestorm01: Merry Christmas you filthy animal 
[3:49:54] predictions Origfx: tendiAAH
[3:49:59] RohanFalcon: Shop obliterated. 
[3:50:03] broadcaster turbo GreatSphynx: but like i have to boost it so that its around -5db peak which to me is low 
[3:50:07] predictions subscriber JoGoBeans: :catpla 
[3:50:09] predictions subscriber JoGoBeans: catPls
[3:50:11] broadcaster turbo GreatSphynx: i try and keep the stream near broadcast standards for audio when ican 
[3:50:14] predictions thedoodler303: catJAMM
[3:50:14] vip uforgot: honky Thonk women 
[3:50:15] woodybasket: catJAMM
[3:50:19] moderator founder turbo Dragoneye77: station Gongo 
[3:50:32] broadcaster turbo GreatSphynx: which realistically probably makes my stream sound really loud to most people since most streams tend to be quiet 
[3:50:38] predictions vip artist-badge Guardison: BERMUS
[3:50:51] DaWhatTheFox: @GreatSphynx Mike's stream is pretty loud 
[3:50:54] moderator partner DesertP: i try to not let noises get over -10 
[3:50:55] DaWhatTheFox: but that's cause he screams a lot 
[3:50:58] LeginNoslen: Your stream is p. loud tbh 
[3:51:07] hexam_project: because loud equals funny? 
[3:51:10] moderator founder turbo Dragoneye77: i love this space station 
[3:51:11] broadcaster turbo GreatSphynx: -3db peak is what most broadcast audio standards are which is what i try to do 
[3:51:12] moderator founder turbo Dragoneye77: its so wacky 
[3:51:23] broadcaster turbo GreatSphynx: but like some stuff on spotify when its at 100% volume goes to 0db but doesnt peak 
[3:51:27] broadcaster turbo GreatSphynx: but thats just music production 
[3:51:36] vip bits Jane_Inferno: how far in are we i was away 
[3:51:40] broadcaster turbo GreatSphynx: and spotify cares more about loudness than actual volume 
[3:51:42] broadcaster turbo GreatSphynx: 3rd episode 
[3:51:43] moderator partner DesertP: i try to make mine not peak at 100% 
[3:51:53] predictions subscriber snosa: lol 
[3:51:54] RohanFalcon: Oh. 
[3:51:56] predictions vip artist-badge Guardison: lmao 
[3:51:56] predictions thedoodler303: LUL
[3:51:56] vip bits Jane_Inferno: i meant into the episode sorry lol 
[3:51:58] RohanFalcon: He just. Okay. 
[3:51:58] predictions vip twitch-recap-2023 Korokun: Deranged 
[3:51:58] broadcaster turbo GreatSphynx: or if you mean in the episode 
[3:51:58] kephyll: me 
[3:51:59] DaWhatTheFox: yum 
[3:51:59] broadcaster turbo GreatSphynx: 5min 
[3:52:00] subscriber hypn0toad5: LUL
[3:52:00] vip Snudl: Yummy Tasty
[3:52:02] moderator founder turbo Dragoneye77: god 
[3:52:02] predictions vip artist-badge Guardison: jarJAM PianoTime
[3:52:04] woodybasket: catJAMM PianoTime
[3:52:04] moderator founder turbo Dragoneye77: he has so much drip 
[3:52:05] predictions subscriber JoGoBeans: catJAMM
[3:52:07] vip uforgot: "Cigarettes. I store them in my stomach." 
[3:52:10] hexam_project: it's just a cigarette 
[3:52:12] predictions deworming_in_progress: i did that once, it burned my throat it hurt extremely bad 
[3:52:16] predictions vip GodliestCat64: chewLes Cigarettes 
[3:52:17] subscriber malty_meatia: We took for granted living in a world where there wasn't an attempted live action version of this 
[3:52:17] poobus: GLEEBING
[3:52:19] vip premium plorf: catPls
[3:52:22] Krabmeats: veryCat
[3:52:33] RohanFalcon: There we go. 
[3:52:47] vip premium plorf: the oldmen 
[3:52:50] moderator founder turbo Dragoneye77: grandpas went to space vegas 
[3:52:52] subscriber malty_meatia: @purahblubber2005 Chevy Chase did that in the Ghostbusters music video, fun fact 
[3:52:52] broadcaster turbo GreatSphynx: i like the subtle bloom they have in a lot of the shots in this show 
[3:53:09] vip uforgot: blum* 
[3:53:16] vip uforgot: :)
[3:53:16] premium AndroidPriest: lmao 
[3:53:17] broadcaster turbo GreatSphynx: dataBruh
[3:53:30] predictions vip GodliestCat64: lol 
[3:53:36] predictions vip twitch-recap-2023 Korokun: I remember there was a thread about recreating that anime bloom in blender or something 
[3:53:46] vip premium plorf: oh yeah they just put a giant ass backlight in 3d 
[3:53:54] predictions subscriber snosa: oh yeah 
[3:53:54] vip premium plorf: instead of letting it bleed through the cel 
[3:53:59] hexam_project: yeah isn't it from the actual lightbox 
[3:54:01] predictions deworming_in_progress: i saw that tweet too lmao 
[3:54:01] predictions thedoodler303: @Korokun I think i saw a video about that 
[3:54:01] broadcaster turbo GreatSphynx: yeah there was someone who did a tutorial and they basically did it how they did it in real 
[3:54:05] vip premium Monopool: I also like to live dangerously 
[3:54:07] predictions subscriber JoGoBeans: wideVIBE
[3:54:10] broadcaster turbo GreatSphynx: sometimes simplest solution is the easiest 
[3:54:30] broadcaster turbo GreatSphynx: catJAMGF
[3:54:37] twitch-recap-2023 Merak_r: catJammingPolitely
[3:54:39] predictions subscriber snosa: catJammingPolitely
[3:54:53] Krabmeats: Cookies :)
[3:54:53] predictions subscriber JoGoBeans: meme frame 
[3:55:16] vip premium plorf: faye drip 
[3:55:17] moderator founder turbo Dragoneye77: vineJape
[3:55:19] Krabmeats: this is the quietest ive ever seen chat here 
[3:55:21] predictions vip GodliestCat64: lol 
[3:55:22] moderator founder turbo Dragoneye77: get japed idiot 
[3:55:25] vip uforgot: atamYada COME BACK HERE 
[3:55:26] vip premium Monopool: :tf:
[3:55:26] vip bits Jane_Inferno: Fallout New Vegas 
[3:55:33] predictions vip artist-badge Guardison: OYOTrip JACKPOT 
[3:55:36] predictions subscriber snosa: WatchingStream
[3:55:37] broadcaster turbo GreatSphynx: chat gets like baby watching disney movie when its actual good content 
[3:55:39] predictions vip GodliestCat64: greats8YoTrip
[3:55:42] predictions subscriber snosa: lol 
[3:55:48] subscriber malty_meatia: OYTrip
[3:55:48] Krabmeats: WatchingStream
[3:55:49] premium AndroidPriest: WatchingStream
[3:55:55] predictions subscriber twitch-recap-2023 Piyokopyo: greats8Ytrip
[3:55:56] predictions vip artist-badge Guardison: not much to jape about because it's good shit 
[3:55:58] predictions vip GodliestCat64: WatchingStream Kino's on 
[3:56:10] predictions subscriber twitch-recap-2023 Piyokopyo: veryCat good content 
[3:56:10] RohanFalcon: I've never seen Cowboy Bebop, but damn. Ain't it good. 
[3:56:11] subscriber twitch-recap-2023 ocarina_boy: WatchingStream
[3:56:23] predictions subscriber JoGoBeans: NO WONDER I'M BROKE 
[3:56:26] broadcaster turbo GreatSphynx: this is only the 3rd episode 
[3:56:26] predictions subscriber twitch-recap-2023 Piyokopyo: chewLes
[3:56:28] predictions vip GodliestCat64: chewLes
[3:56:29] moderator founder turbo Dragoneye77: yum 
[3:56:29] subscriber twitch-recap-2023 ocarina_boy: Tasty
[3:56:29] predictions vip artist-badge Guardison: Fucking psycho 
[3:56:30] predictions deworming_in_progress: chewLes
[3:56:31] vip uforgot: Tasty
[3:56:31] kephyll: bro is HUNGRY 
[3:56:31] predictions subscriber snosa: spike stop voring shit 
[3:56:31] twitch-recap-2023 Merak_r: Crunch
[3:56:32] predictions thedoodler303: chewLes
[3:56:32] premium AndroidPriest: this mans solution is to eat everything 
[3:56:33] Takamatsu2: LUL
[3:56:34] predictions vip artist-badge Guardison: I love him 
[3:56:34] vip bits Jane_Inferno: chewLes
[3:56:37] broadcaster turbo GreatSphynx: tbh it doesnt have much continuity outside like the first several episodes and last few 
[3:56:41] predictions subscriber twitch-recap-2023 Piyokopyo: man just wants to eat chip 
[3:56:43] predictions subscriber snosa: LMAO 
[3:56:43] subscriber malty_meatia: veryCat
[3:56:43] predictions vip twitch-recap-2023 squirrelcabinet: siskoPulp
[3:56:45] vip uforgot: QuatSpynx Tasty
[3:56:47] broadcaster turbo GreatSphynx: like the first few add all the characters to the show basically 
[3:56:52] Bladestorm01: I only watch the first 2 episode of this 
[3:56:53] broadcaster turbo GreatSphynx: and the last few wrap it up 
[3:57:03] kephyll: zesty ass counter 
[3:57:04] broadcaster turbo GreatSphynx: there arent a lot of episodes though 
[3:57:06] broadcaster turbo GreatSphynx: just like 25 and a movie 
[3:57:10] broadcaster turbo GreatSphynx: catJAM catJAM catJAM catJAM
[3:57:13] broadcaster turbo GreatSphynx: i love this song 
[3:57:13] whisperstatic: limesPop
[3:57:13] hexam_project: he ate hot cig and lie 
[3:57:14] predictions vip GodliestCat64: catJAM
[3:57:14] predictions vip twitch-recap-2023 squirrelcabinet: catPls
[3:57:14] predictions subscriber snosa: catJAM
[3:57:16] predictions vip twitch-recap-2023 Korokun: Big O 
[3:57:17] predictions thedoodler303: catJAM
[3:57:17] predictions vip artist-badge Guardison: catJAM
[3:57:17] predictions subscriber twitch-recap-2023 Piyokopyo: big O, showtime 
[3:57:18] twitch-recap-2023 Merak_r: catJAM
[3:57:18] subscriber hypn0toad5: catJAM
[3:57:18] Blocknight1: catJAM
[3:57:20] predictions subscriber JoGoBeans: catJAM
[3:57:21] predictions vip artist-badge Guardison: Big O is great too 
[3:57:21] vip premium plorf: catJAM
[3:57:21] poobus: banger 
[3:57:22] Krabmeats: that is a TINY button!!! 
[3:57:23] vip afiddler: ratJAM
[3:57:24] DaWhatTheFox: catJAMPARTY
[3:57:24] moderator founder turbo Dragoneye77: Fayes ship is pretty cool 
[3:57:24] subscriber malty_meatia: NESSIE NESSIE NESSIE
[3:57:26] predictions subscriber snosa: catJAM catJAM catJAM
[3:57:28] moderator founder turbo Dragoneye77: though Spikes takes the cake 
[3:57:31] vip Snudl: catJAM PianoTime siskoPulp
[3:57:36] Krabmeats: shadroBreak
[3:57:42] predictions vip artist-badge Guardison: Poor Jett 
[3:58:27] moderator founder turbo Dragoneye77: wow thats a cool detail 
[3:58:30] Bladestorm01: monkaS
[3:58:34] predictions vip artist-badge Guardison: lmao 
[3:58:35] moderator founder turbo Dragoneye77: that have the cables of the missiles in that scene 
[3:58:37] vip uforgot: tendiAAH
[3:58:38] predictions subscriber snosa: Bleh
[3:58:41] moderator founder turbo Dragoneye77: because they are wire guided missiles 
[3:58:49] Bladestorm01: oh
[3:59:00] moderator founder turbo Dragoneye77: is he okay 
[3:59:06] broadcaster turbo GreatSphynx: catPls
[3:59:06] predictions subscriber snosa: he's fine :)
[3:59:06] RohanFalcon: Yeah. I'm sure. 
[3:59:08] vip uforgot: odoPulp
[3:59:08] twitch-recap-2023 WolfzenSkiigh: he'll be fine 
[3:59:08] DaWhatTheFox: eepy 
[3:59:09] predictions vip artist-badge Guardison: yeah he just has a wicked headache 
[3:59:15] bits-charity CptHungrySpy: Mr House isn't gonna be pleased 
[3:59:22] Krabmeats: graffitti! D:
[3:59:24] predictions subscriber twitch-recap-2023 Piyokopyo: MEEKA
[3:59:24] predictions vip GodliestCat64: D:
[3:59:26] Jairus: D:
[3:59:27] subscriber robotsnake: D:
[3:59:28] vip twitch-recap-2023 viahate: D:
[3:59:30] subscriber hypn0toad5: D:
[3:59:30] predictions thedoodler303: D:
[3:59:31] woodybasket: D:
[3:59:31] vip premium Monopool: you made me look bad 
[3:59:33] subscriber malty_meatia: Random Spike Lookalike will return in... AVENGERS ENDGAME 
[3:59:37] RohanFalcon: Stupid dog! You make me look- Yeah. 
[3:59:39] predictions deworming_in_progress: is she in the shitter 
[3:59:39] Bladestorm01: DON'T INSULT EIN 
[3:59:46] Krabmeats: shadroShock
[3:59:51] predictions subscriber twitch-recap-2023 Piyokopyo: she poopin 
[3:59:59] predictions vip GodliestCat64: lmao 
[4:00:03] predictions subscriber snosa: lol 
[4:00:03] whisperstatic: PopNemo
[4:00:04] predictions thedoodler303: LUL
[4:00:06] Takamatsu2: spynxBuh
[4:00:09] twitch-recap-2023 WheresColonelPopcorn: unvore 
[4:00:12] predictions subscriber JoGoBeans: That's disgusting! *grabs it* 
[4:00:18] subscriber malty_meatia: MEEKA MEEKA MEEKA
[4:00:27] subscriber hypn0toad5: MEEKA
[4:00:27] Bladestorm01: LUL
[4:00:36] moderator founder turbo Dragoneye77: didnt think to search her 
[4:00:43] twitch-recap-2023 WheresColonelPopcorn: So they just pissing in bottles till this is all solved 
[4:00:45] predictions subscriber JoGoBeans: catJAM
[4:00:46] subscriber twitch-recap-2023 ocarina_boy: 🤠 
[4:00:46] predictions subscriber snosa: catPls
[4:00:47] vip twitch-recap-2023 viahate: catJAM catJAM catJAM
[4:00:47] broadcaster turbo GreatSphynx: catJAM
[4:00:47] moderator founder turbo Dragoneye77: diANE
[4:00:47] predictions vip artist-badge Guardison: catJAM
[4:00:47] twitch-recap-2023 Merak_r: catPls
[4:00:47] subscriber robotsnake: catPls
[4:00:48] vip premium plorf: catPls
[4:00:48] predictions vip twitch-recap-2023 squirrelcabinet: catJAM
[4:00:48] Krabmeats: veryCat
[4:00:49] predictions subscriber twitch-recap-2023 Piyokopyo: catJAM
[4:00:53] predictions thedoodler303: catPls
[4:00:54] predictions deworming_in_progress: odoAWOOGA HI AMIGOS 
[4:00:54] vip uforgot: odoAWOOGA
[4:00:54] Jairus: catPls GuitarTime
[4:00:55] predictions Origfx: Funnywhitecat5
[4:01:02] RohanFalcon: jmikeKromegalul Big shot! 
[4:01:03] twitch-recap-2023 WolfzenSkiigh: Set lipstick to KILL 
[4:01:03] vip Snudl: [BIG SHOT] 
[4:01:25] Bladestorm01: it upgrades the securitron With Rockets launcher 
[4:01:28] Krabmeats: shadroOO
[4:01:35] broadcaster turbo GreatSphynx: WAYTOODANK
[4:01:56] moderator founder turbo Dragoneye77: BERMAN
[4:02:05] predictions vip artist-badge Guardison: TREKW
[4:02:27] predictions vip GodliestCat64: TREKW
[4:02:32] predictions thedoodler303: TREKW
[4:02:39] vip uforgot: atamBop
[4:02:40] predictions vip artist-badge Guardison: Oop 
[4:02:46] predictions deworming_in_progress: AWOO 
[4:02:47] predictions subscriber twitch-recap-2023 Piyokopyo: OhMyDog
[4:02:47] Takamatsu2: awoo 
[4:02:49] Jairus: OhMyDog
[4:02:50] predictions subscriber snosa: awoooo 
[4:02:55] predictions Origfx: OTrip space gypsies 
[4:03:26] moderator founder turbo Dragoneye77: REED ALERT
[4:03:29] predictions subscriber JoGoBeans: catPls
[4:03:33] predictions thedoodler303: catPls
[4:03:40] subscriber twitch-recap-2023 ocarina_boy: catPls DrumTime
[4:03:42] Bladestorm01: MR HOUSE 
[4:03:52] AnodyneVS: catPls
[4:03:53] KillerQ13: Myotismon? 
[4:03:58] subscriber robotsnake: majinoBoogy sarueiDance sarueiCheer sarueiDance majinoBoogy
[4:04:05] Takamatsu2: nft 
[4:04:07] predictions vip artist-badge Guardison: The House Always Wins 
[4:04:08] moderator founder turbo Dragoneye77: Chatgpt 
[4:04:29] Bladestorm01: Securitron Upgrade 
[4:05:26] broadcaster turbo GreatSphynx: ill be honest i am really surprised this show didnt get like spun off into a huge franchise 
[4:05:30] broadcaster turbo GreatSphynx: or that they didnt continue it 
[4:05:33] vip premium plorf: im glad 
[4:05:35] broadcaster turbo GreatSphynx: i know it took a little while to get popular 
[4:05:44] moderator founder turbo Dragoneye77: well it had a movie to 
[4:05:57] predictions subscriber JoGoBeans: better for it to have a short ride 
[4:06:01] predictions vip artist-badge Guardison: It's probably best it didn't go forever 
[4:06:01] predictions subscriber twitch-recap-2023 Piyokopyo: i'm glad it didn't 
[4:06:02] subscriber robotsnake: Isn't space dandy a spin off of this? 
[4:06:02] predictions Origfx: could they really continue it with how it ended? 
[4:06:05] predictions subscriber twitch-recap-2023 Piyokopyo: it wrapped up nicely 
[4:06:10] broadcaster turbo GreatSphynx: is it idk ive never seen space dandy 
[4:06:13] vip premium plorf: 2001 
[4:06:13] bits-charity CptHungrySpy: She raided their fridge 
[4:06:14] whisperstatic: they were going to give all the spin offs to the Netflix show :)
[4:06:14] Jairus: LUL
[4:06:15] broadcaster turbo GreatSphynx: yeah i agree it is a nice package 
[4:06:16] broadcaster turbo GreatSphynx: its still just 
[4:06:18] broadcaster turbo GreatSphynx: surprising 
[4:06:18] predictions vip artist-badge Guardison: Space Dandy is kind of a spiritual successor 
[4:06:19] vip premium plorf: space dandy is fuckin great 
[4:06:20] predictions vip twitch-recap-2023 squirrelcabinet: Wowee
[4:06:20] predictions subscriber snosa: spacy dandy wasn't that good 
[4:06:22] twitch-recap-2023 WolfzenSkiigh: OhMyDog
[4:06:23] subscriber twitch-recap-2023 ocarina_boy: MEEKA
[4:06:25] biggerj1: chewbacca-ass growling 
[4:06:26] Bladestorm01: GO GET HER EIN 
[4:06:27] vip Snudl: RAGEY
[4:06:39] vip uforgot: this started and ended in a single season... there were no continuations or spinoffs 
[4:06:41] RohanFalcon: I've only heard good things of Bebop. Sometimes, a story needs a good end. And to stay the end. 
[4:06:44] moderator partner DesertP: space dandy references the show and is implied to take place thousands of years later 
[4:06:44] predictions thedoodler303: @bunninu D: You take that back 
[4:06:48] bits-charity CptHungrySpy: tossing anything in outer space 
[4:06:51] moderator partner DesertP: thats about it 
[4:06:51] bits-charity CptHungrySpy: LUL
[4:06:58] premium AndroidPriest: i really liked space dandy 
[4:07:03] moderator founder turbo Dragoneye77: ah yes 
[4:07:04] moderator founder turbo Dragoneye77: space bullet 
[4:07:05] broadcaster turbo GreatSphynx: catJAM
[4:07:09] predictions subscriber snosa: @thedoodler303 i'm sorry!!!! just my onion!! 
[4:07:10] predictions subscriber twitch-recap-2023 Piyokopyo: catJAM
[4:07:11] predictions subscriber JoGoBeans: catJAM
[4:07:11] AnodyneVS: catJAM
[4:07:11] vip premium plorf: catPls
[4:07:12] predictions vip GodliestCat64: catJAM
[4:07:12] predictions vip artist-badge Guardison: catJAM jam time 
[4:07:13] twitch-recap-2023 Merak_r: catJAM
[4:07:13] predictions thedoodler303: catJAM
[4:07:15] predictions vip GodliestCat64: This part is great 
[4:07:16] broadcaster turbo GreatSphynx: oh thousands of years? 
[4:07:17] vip twitch-recap-2023 viahate: catJAM Funnywhitecat5 catJAM
[4:07:21] subscriber twitch-recap-2023 ocarina_boy: catJAM
[4:07:22] twitch-recap-2023 WheresColonelPopcorn: sandecWiggle
[4:07:23] predictions horsephallusdan: catJAM SaxTime
[4:07:23] subscriber robotsnake: Honestly my problem with anime is that there are some really good ones but they go on for way too long 
[4:07:27] bits-charity CptHungrySpy: guns... in outer space 
[4:07:33] subscriber twitch-recap-2023 ocarina_boy: catJAM HYPERDRUMTIME
[4:07:35] predictions vip artist-badge Guardison: that man is dead 
[4:07:36] broadcaster turbo GreatSphynx: i dont watch a lot of anime 
[4:07:38] predictions subscriber snosa: yeah like bebop is the perfect length 
[4:07:38] predictions vip artist-badge Guardison: in the worst way 
[4:07:38] broadcaster turbo GreatSphynx: so 
[4:07:40] Jairus: zentreWICKED
[4:07:43] AnodyneVS: catJAM TrumpetTime
[4:07:50] vip premium plorf: 26 episodes is ideal 
[4:07:51] broadcaster turbo GreatSphynx: but i could see that, ive seen some shows that have like hundreds of episodes or w/e 
[4:07:58] broadcaster turbo GreatSphynx: i guess it depends on the story you are trying to tell 
[4:08:05] subscriber robotsnake: yea true 
[4:08:08] broadcaster turbo GreatSphynx: id just like more stuff set in this world but maybe it wouldnt be as cool without spike and jett 
[4:08:13] bits-charity CptHungrySpy: Are the movies cannon? 
[4:08:16] predictions subscriber twitch-recap-2023 Piyokopyo: i don't know how people watch animes that are like 1000+ episodes 
[4:08:18] moderator partner DesertP: space dandy might as well be its own thing its tonally completely different although it has a lot of really cool trippy episodes that are just animation experiments 
[4:08:21] broadcaster turbo GreatSphynx: i know there is other stuff that is similar to like this near future stuff 
[4:08:23] predictions subscriber twitch-recap-2023 Piyokopyo: its like watching a soap 
[4:08:28] vip premium plorf: i love space dandy so much 
[4:08:29] moderator partner DesertP: youd like it sphynx it makes fun of trek a lot 
[4:08:31] broadcaster turbo GreatSphynx: the movie for this takes place between like episodes 23 and 24 i think 
[4:08:34] vip uforgot: that Macross Plus tech 
[4:08:35] vip premium plorf: its riffing on this as a concept basically 
[4:08:35] moderator founder turbo Dragoneye77: a lot of what makes cowbo bebop nice is the setting 
[4:08:38] broadcaster turbo GreatSphynx: so yes its canon 
[4:08:39] moderator founder turbo Dragoneye77: but also the characters to 
[4:08:41] subscriber twitch-recap-2023 ocarina_boy: catBoom
[4:08:42] predictions subscriber JoGoBeans: Explosion
[4:08:45] subscriber malty_meatia: The tone and aesthetic of this show is top notch, truly 
[4:08:48] vip twitch-recap-2023 bruxisma: @GreatSphynx the games do as well I think 
[4:08:51] Bladestorm01: rip mr house 
[4:08:58] hexam_project: case in point, detective conan, still no resolution after 1109 episodes and 26 movies 
[4:09:07] predictions subscriber JoGoBeans: wideVIBE
[4:09:08] AnodyneVS: Outlaw star has some of the vibe 
[4:09:09] subscriber robotsnake: yea the movie is cool and was surprised when I found out it is canon 
[4:09:16] Krabmeats: Main Deflektor Array dataBruh
[4:09:21] hexam_project: at least the original pokemon finally got a resolution 
[4:09:27] moderator partner DesertP: wait the movie is canon? wild 
[4:09:27] whisperstatic: Actually, there is a cowboy bebop spinoff. Carol and Tuesday is set in the same universe 
[4:09:30] broadcaster turbo GreatSphynx: catJAMGF
[4:09:32] predictions subscriber JoGoBeans: wideVIBE wideVIBE wideVIBE wideVIBE
[4:09:32] predictions subscriber twitch-recap-2023 Piyokopyo: catJAMM
[4:09:33] Takamatsu2: catJAMGF
[4:09:34] predictions vip artist-badge Guardison: catJAMGF
[4:09:34] subscriber malty_meatia: Clap Clap Clap
[4:09:34] predictions vip GodliestCat64: wideVIBE
[4:09:35] predictions thedoodler303: wideVIBE
[4:09:35] subscriber twitch-recap-2023 ocarina_boy: catJamrgb Clap
[4:09:37] predictions vip artist-badge Guardison: yeah the movie is canon 
[4:09:37] vip twitch-recap-2023 viahate: wideVIBE
[4:09:38] vip artist-badge Raxxmus: catJAMGF
[4:09:39] predictions subscriber partner Temiree: wideVIBE
[4:09:39] Bladestorm01: DinoDance DinoDance DinoDance DinoDance DinoDance DinoDance DinoDance
[4:09:41] twitch-recap-2023 WolfzenSkiigh: catJammingPolitely
[4:09:41] bits-charity CptHungrySpy: This jam... 
[4:09:42] DaWhatTheFox: catJAMPARTY catJAMPARTY
[4:09:42] subscriber robotsnake: sarueiDance
[4:09:43] vip bits Jane_Inferno: Clap
[4:09:43] Krabmeats: shadroJAM
[4:09:46] subscriber hypn0toad5: wideVIBE
[4:09:47] AnodyneVS: jmikeSadbungle Clap
[4:09:48] predictions horsephallusdan: catJAMGF DrumTime
[4:09:55] cheapsushidragon: VIBE
[4:09:57] vip premium lmaoboat: Yuore gonna carry that wheat 
[4:10:09] premium Tac_Kilala: jmikeSadbungle The real folk blues 
[4:10:13] vip artist-badge Raxxmus: the movie is fine but I feel like its the least interesting story in comparison to like every other episode 
[4:10:13] predictions horsephallusdan: the real folk bluues 
[4:10:16] predictions subscriber twitch-recap-2023 Piyokopyo: wideVIBE THE REEEAAAL FOLK BLUES 
[4:10:16] subscriber twitch-recap-2023 ocarina_boy: THE REAL FOOOLK BLUES 
[4:10:16] subscriber malty_meatia: Time for Sleepo BedgeCat
[4:10:17] predictions subscriber JoGoBeans: Adult Swim why did you skip these credits when the slideshow display Spike's backstory RAGEY
[4:10:21] DaWhatTheFox: catJamrgb
[4:10:21] broadcaster turbo GreatSphynx: yeah its just a long episode 
[4:10:24] subscriber robotsnake: THE REAL FOLK BLUUUUES 
[4:10:28] predictions subscriber snosa: wideVIBE
[4:10:32] vip artist-badge Raxxmus: yeah but its not a particularly good one imo 
[4:10:34] superultracombo-2023 Raytwist: THE REALGOOOOONG GUES 
[4:10:43] broadcaster turbo GreatSphynx: the animation quality in lots of parts is pretty good though 
[4:10:44] vip premium lmaoboat: Sometimes a long episode is okay 
[4:10:51] vip artist-badge Raxxmus: I wish they did something a little more unique for a feature but I guess they maybe didn't want to turn people off it too much 
[4:10:59] broadcaster turbo GreatSphynx: its a better long episode than star trek insurection dataBruh
[4:11:01] vip artist-badge Raxxmus: the animation is great though yeah 
[4:11:05] vip artist-badge Raxxmus: lol 
[4:11:08] whisperstatic: It's also where we got "I love the kind of woman who can kick my ass." 
[4:11:11] predictions subscriber JoGoBeans: good episode OYOTrip
[4:11:20] vip uforgot: the same guys did the macross plus movie, if you're into some similar style animation 
[4:11:28] Kestrel707: atpSpiner
[4:11:29] broadcaster turbo GreatSphynx: was this one of the episodes that they didnt originally air on adult swim 
[4:11:30] premium Tac_Kilala: these transitions remind me of house of the dead lmao 
[4:11:35] vip premium plorf: yeah i have the ova downloaded 
[4:11:39] moderator founder turbo Dragoneye77: this episode is pretty weird 
[4:11:39] AnodyneVS: catJAM YES 
[4:11:40] DaWhatTheFox: OYZTrip
[4:11:40] subscriber twitch-recap-2023 ocarina_boy: catJAM
[4:11:41] predictions vip artist-badge Guardison: catJAM
[4:11:41] predictions vip twitch-recap-2023 squirrelcabinet: catPls
[4:11:42] predictions subscriber snosa: catJAM catJAM catJAM catJAM catJAM
[4:11:42] Bladestorm01: Fucking space green peace 
[4:11:43] predictions thedoodler303: catJAM
[4:11:45] vip twitch-recap-2023 bruxisma: catJAM
[4:11:45] subscriber robotsnake: catJAM
[4:11:46] twitch-recap-2023 WolfzenSkiigh: @GreatSphynx I remember seeing it on there back way when 
[4:11:46] Akoborb: DinoDance DinoDance DinoDance
[4:11:48] predictions subscriber JoGoBeans: catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM
[4:11:48] Krabmeats: I've already taken care of. . . G. 
[4:11:48] twitch-recap-2023 Fireborn: catJAM HYPERDRUMTIME
[4:11:49] predictions horsephallusdan: catJAM 3 2 1 lets go 
[4:11:50] moderator partner DesertP: pogonaRave
[4:11:50] DaWhatTheFox: catJAM catJAM catJAM catJAM
[4:11:50] vip twitch-recap-2023 viahate: catJAM catJAM catJAM
[4:11:52] premium nickynack: catJAM
[4:11:52] subscriber KatalepsyKills: catJAM
[4:11:52] predictions thedoodler303: catJAM Lets jam catJAM
[4:11:53] vip afiddler: catJAM
[4:11:53] predictions vip artist-badge Guardison: catJAM
[4:11:54] vip Snudl: catJAM TrumpetTime
[4:11:55] AnodyneVS: catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM
[4:11:56] twitch-recap-2023 DoctorDringuz: merry x peepz 
[4:11:57] broadcaster turbo GreatSphynx: there were like 3 episodes i think they didnt air like the first 1 or 2 times they showed it on cartoon network 
[4:11:57] premium Tac_Kilala: jmikeSquandance TwitchConHYPE vineKermiepls
[4:11:58] predictions subscriber twitch-recap-2023 Piyokopyo: catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM catJAM
[4:11:58] broadcaster turbo GreatSphynx: but then like 
[4:11:59] premium AndroidPriest: catJAM
[4:11:59] predictions vip artist-badge Guardison: catJAM NEVER skip TANK catJAM
[4:12:00] broadcaster turbo GreatSphynx: later they did 
[4:12:03] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8SPRIGGLE greats8JAM greats8SPRIGGLE greats8JAM greats8SPRIGGLE greats8JAM
[4:12:03] broadcaster turbo GreatSphynx: cuz of 9/11 
[4:12:05] subscriber premium Yeven_Fox: catJAM catJAM catJAM catJAM catJAM catJAM
[4:12:06] predictions subscriber partner Temiree: dogkingBuiJAM
[4:12:07] vip uforgot: goblinPls (ditto) SPRIGGLE
[4:12:09] twitch-recap-2023 DoctorDringuz: Corn
[4:12:10] predictions horsephallusdan: catJAM SaxTime
[4:12:10] subscriber robotsnake: majinoBoogy sarueiDance sarueiCheer sarueiDance majinoBoogy
[4:12:18] broadcaster turbo GreatSphynx: oh it was 6, 8 and 22 
[4:12:18] RohanFalcon: You know, funny thing. First I heard of this song was a Line Rider video way back when. I never knew where it came from until much later. 
[4:12:20] predictions subscriber twitch-recap-2023 Piyokopyo: they skipped 6 and 8 
[4:12:23] vip uforgot: WeirdCat TrumpetTime
[4:12:32] Krabmeats: shadroBreak
[4:12:32] twitch-recap-2023 WolfzenSkiigh: Oh I think I can imagine one of those episodes actually lmao 
[4:12:38] DaWhatTheFox: AlienDance
[4:12:41] broadcaster turbo GreatSphynx: im sure i've seen them but i cant remember 
[4:12:42] subscriber robotsnake: I know that there was some episodes of certain Gundam series that didn't air on toonami 
[4:12:45] premium Tac_Kilala: jmikeQuota
[4:12:47] broadcaster turbo GreatSphynx: its been a long time since ive rewatched this 
[4:12:47] predictions subscriber snosa: quarkDance quarkDance quarkDance quarkDance
[4:12:49] broadcaster turbo GreatSphynx: like maybe 2008 or 9 
[4:12:50] AnodyneVS: catJAM TrumpetTime
[4:12:51] predictions vip twitch-recap-2023 Korokun: I wonder if there's episodes I've missed 
[4:12:56] premium nickynack: catJAM
[4:12:56] vip twitch-recap-2023 viahate: catJAM TrumpetTime
[4:12:56] predictions subscriber JoGoBeans: catJAM TrumpetTime
[4:12:58] predictions vip artist-badge Guardison: catJAM TrumpetTime
[4:12:58] predictions thedoodler303: catJAM
[4:12:59] subscriber robotsnake: Didn't know they didn't didn't show episodes for cowboy bebop 
[4:13:00] predictions subscriber snosa: catJAM
[4:13:01] subscriber twitch-recap-2023 ocarina_boy: catJAM TrumpetTime
[4:13:02] twitch-recap-2023 franceybear: catBoom
[4:13:04] broadcaster turbo GreatSphynx: i watched it when it first aired and recorded it all on vhs 
[4:13:11] subscriber robotsnake: cool 
[4:13:12] predictions subscriber snosa: aw that's cool 
[4:13:12] vip premium plorf: sick 
[4:13:18] broadcaster turbo GreatSphynx: yeah cuz they literally like 
[4:13:18] predictions vip GodliestCat64: I like this episode 
[4:13:21] vip Snudl: @RohanFalcon You know what, might have been the same for me TREKW
[4:13:23] vip artist-badge Raxxmus: I think I rewatched this all last year 
[4:13:25] DaWhatTheFox: mm juic 
[4:13:25] twitch-recap-2023 WolfzenSkiigh: vintage vibes 
[4:13:26] broadcaster turbo GreatSphynx: started airing this at the beginning of september 2001 
[4:13:26] predictions subscriber JoGoBeans: Salt 
[4:13:27] twitch-recap-2023 Merak_r: space juice 
[4:13:28] predictions subscriber twitch-recap-2023 Piyokopyo: it started airing in september, 2001 
[4:13:28] predictions Origfx: succ 
[4:13:29] broadcaster turbo GreatSphynx: like a week before 9/11 
[4:13:30] predictions vip twitch-recap-2023 Korokun: Yeah I definitely watched all of the first run, don't remember if I watched later showings that had the missing eps 
[4:13:32] vip premium plorf: wow 
[4:13:33] predictions subscriber snosa: ohhh 
[4:13:40] subscriber robotsnake: wow 
[4:13:41] Bladestorm01: oh wow 
[4:13:42] broadcaster turbo GreatSphynx: which is why they didnt air a few episodes on the initial airing 
[4:13:47] twitch-recap-2023 duke1102: English dub WutFace
[4:13:48] moderator founder turbo Dragoneye77: 30 mil gone in a day 
[4:14:02] RohanFalcon: @RohanFalcon Just how it is sometimes. 
[4:14:03] KillerQ13: ikr 
[4:14:04] sub-gifter NastyRedX: imagine finding out about anime and 9/11 on the same day 
[4:14:06] broadcaster turbo GreatSphynx: catPls catPls
[4:14:07] predictions subscriber JoGoBeans: @duke1102 the English dub is great wym 
[4:14:08] predictions subscriber twitch-recap-2023 Piyokopyo: Yeat
[4:14:09] twitch-recap-2023 Merak_r: catJAMM
[4:14:09] AnodyneVS: catPls
[4:14:12] DaWhatTheFox: chatPls
[4:14:13] vip twitch-recap-2023 bruxisma: catPls
[4:14:13] Rooks_Castle: catPls
[4:14:17] twitch-recap-2023 WheresColonelPopcorn: Okay that makes sense now. Having an episode with any kind of "terrorists" in it would be a bad look 
[4:14:17] broadcaster turbo GreatSphynx: this was def not the first anime/manga thing i saw 
[4:14:18] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM
[4:14:18] predictions subscriber partner Temiree: catPls
[4:14:19] moderator partner DesertP: pogonaDance
[4:14:22] premium hooligan_julian: catPls
[4:14:23] twitch-recap-2023 Fireborn: jarJAM
[4:14:26] predictions subscriber JoGoBeans: pogonaDance
[4:14:27] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Bounce greats8Bounce greats8Bounce greats8Bounce
[4:14:30] broadcaster turbo GreatSphynx: i was actually like super into anime when i was really yo ung 
[4:14:33] predictions vip twitch-recap-2023 Korokun: Mine had to have been sailor moon or something 
[4:14:37] hexam_project: even advance wars was released a day earlier than normal to be different 
[4:14:40] moderator founder turbo Dragoneye77: sea rat 
[4:14:44] predictions thedoodler303: @duke1102 This is one of those few animes with good dubs 
[4:14:44] vip artist-badge Raxxmus: mmmm sea rat 
[4:14:46] predictions Origfx: mine was scryed I think 
[4:14:48] broadcaster turbo GreatSphynx: like pre-pokemon like original dbz airing and some other stuff 
[4:14:57] predictions subscriber snosa: aw nice 
[4:14:59] broadcaster turbo GreatSphynx: but then when igot older and it got more mainstream here i thought it was cringe dataBruh
[4:15:02] predictions Origfx: or trigun 
[4:15:06] subscriber robotsnake: Sea rat sounds like some type of shark lol 
[4:15:07] predictions subscriber snosa: lol 
[4:15:10] premium Tac_Kilala: same I remember watching this in its entirety when it aired on adult swim in 2001, it was the best thing on a Saturday night for me 
[4:15:14] vip artist-badge Raxxmus: most anime is cringe tbf 
[4:15:19] predictions subscriber snosa: yeah fr 
[4:15:22] AnodyneVS: i watched it back then too, funny thing is i somehow didn't learn the word anime until my teens. i was just like 7 or 8 and to me it was just "cooler cartoons" 
[4:15:22] broadcaster turbo GreatSphynx: also like the majority of anime i have seen that i like is like late 70s into mid 90s 
[4:15:23] predictions vip twitch-recap-2023 Korokun: It's Space Dandy 
[4:15:24] predictions vip artist-badge Guardison: There he is, space dandy 
[4:15:28] vip twitch-recap-2023 bruxisma: proto space dandy 
[4:15:29] predictions deworming_in_progress: that's mr. dandy 
[4:15:29] predictions subscriber JoGoBeans: it's the space dandy 
[4:15:30] broadcaster turbo GreatSphynx: i dont know how much recent stuff ive seen 
[4:15:35] moderator founder turbo Dragoneye77: thats her 
[4:15:37] predictions vip twitch-recap-2023 squirrelcabinet: Crunch
[4:15:37] bits-charity CptHungrySpy: Big Mom 
[4:15:38] predictions subscriber snosa: i barely watch anime anymore 
[4:15:39] moderator founder turbo Dragoneye77: madam gongo
[4:15:42] vip uforgot: ratJAM
[4:15:42] vip premium plorf: i like 4:3 anime 
[4:15:50] vip premium plorf: ive been rewatching eureka seven 
[4:15:51] twitch-recap-2023 duke1102: @thedoodler303 I can tell now, it's somewhat decent, but I still prefer original dub with subs. :D
[4:15:52] DaWhatTheFox: crunch 
[4:15:53] predictions vip artist-badge Guardison: zzooTrip
[4:15:53] predictions subscriber twitch-recap-2023 Piyokopyo: Crunch
[4:15:58] premium Iceckryss: I like reading manga better 
[4:16:00] predictions Origfx: OYZTrip mama 
[4:16:02] twitch-recap-2023 WheresColonelPopcorn: Yeah I used to watch everything that came out on Adult Swim and then just dropped it completely about 10 years ago 
[4:16:05] predictions subscriber JoGoBeans: RAGEY
[4:16:05] predictions vip artist-badge Guardison: zzooTrip forgot that was his name 
[4:16:08] subscriber robotsnake: Oh shit its the Major 
[4:16:11] predictions subscriber snosa: i prefer manga too 
[4:16:12] twitch-recap-2023 WheresColonelPopcorn: every *anime 
[4:16:14] predictions thedoodler303: @duke1102 Thats fair 
[4:16:20] DaWhatTheFox: RATS 
[4:16:21] vip uforgot: did he just photoshop the dude 
[4:16:23] subscriber twitch-recap-2023 ocarina_boy: ratJAM
[4:16:23] Takamatsu2: rat bois 
[4:16:24] predictions deworming_in_progress: jmikeRatgirl
[4:16:25] predictions subscriber twitch-recap-2023 Piyokopyo: ratJAM
[4:16:26] predictions subscriber JoGoBeans: ratJAM
[4:16:27] predictions vip artist-badge Guardison: RAT GANG 
[4:16:27] predictions thedoodler303: jmikeRatgirl
[4:16:27] moderator founder turbo Dragoneye77: monkaS
[4:16:28] vip afiddler: ratJAM
[4:16:29] vip premium plorf: ratJAM
[4:16:31] Bladestorm01: PETA 
[4:16:31] predictions vip GodliestCat64: ratJAM
[4:16:33] predictions subscriber JoGoBeans: love this episode 
[4:16:36] predictions Origfx: TREKW
[4:16:39] predictions subscriber twitch-recap-2023 Piyokopyo: tendiAAH
[4:16:40] Lyvash: ratJAM
[4:16:40] moderator founder turbo Dragoneye77: is he okay 
[4:16:40] predictions vip twitch-recap-2023 squirrelcabinet: catBoom
[4:16:41] predictions Origfx: sweatFrog
[4:16:42] vip artist-badge Raxxmus: based? 
[4:16:44] vip uforgot: ratJAM ratJAM ratJAM ratJAM
[4:16:44] subscriber twitch-recap-2023 ocarina_boy: ratJAM ratJAM jmikeRatgirl ratJAM ratJAM
[4:16:47] twitch-recap-2023 WheresColonelPopcorn: Rekt 
[4:16:53] predictions thedoodler303: He's fine :)
[4:16:59] moderator founder turbo Dragoneye77: fucking space peta 
[4:16:59] predictions vip GodliestCat64: lol 
[4:16:59] sub-gifter NastyRedX: idk my first anime but I first read fruits basket at like 12 TREKW
[4:17:01] predictions vip twitch-recap-2023 squirrelcabinet: catPls
[4:17:01] predictions subscriber twitch-recap-2023 Piyokopyo: catPls
[4:17:02] vip premium plorf: catPls
[4:17:02] predictions subscriber partner Temiree: slushedBANG
[4:17:03] predictions subscriber JoGoBeans: catJAM
[4:17:03] predictions vip artist-badge Guardison: catPls
[4:17:04] AnodyneVS: catPls
[4:17:04] DaWhatTheFox: catPls
[4:17:05] predictions vip GodliestCat64: catPls
[4:17:05] predictions subscriber JoGoBeans: catPls
[4:17:06] no_video CrazyLaugh1: catPls
[4:17:06] Lyvash: catPls
[4:17:06] predictions Origfx: catPls
[4:17:07] vip twitch-recap-2023 bruxisma: catPls
[4:17:07] predictions subscriber partner Temiree: catPls
[4:17:08] predictions thedoodler303: catPls
[4:17:09] subscriber twitch-recap-2023 ocarina_boy: catPls
[4:17:09] vip uforgot: catPls
[4:17:10] predictions horsephallusdan: catPls
[4:17:10] superultracombo-2023 Left_Justified: TwitchConHYPE
[4:17:11] predictions subscriber snosa: aww i loved fruits basket lol 
[4:17:12] predictions subscriber JoGoBeans: mass murder catPls
[4:17:12] twitch-recap-2023 WolfzenSkiigh: catPls
[4:17:14] bits-charity CptHungrySpy: I see Greenpeace is still operating well 
[4:17:15] montrith: I've seen worse circuses 
[4:17:15] vip artist-badge Raxxmus: catJammingPolitely
[4:17:18] moderator partner DesertP: catPls
[4:17:18] predictions subscriber twitch-recap-2023 Piyokopyo: environment successfully preserved catPls
[4:17:19] whisperstatic: starBlob
[4:17:20] twitch-recap-2023 WheresColonelPopcorn: sandecWiggle sandecWiggle
[4:17:23] twitch-recap-2023 Fireborn: catPls eco terrorism 
[4:17:27] RohanFalcon: What a nice little calling card. 
[4:17:28] vip Snudl: catPls Murder for the environment catPls
[4:17:31] AnodyneVS: ratJAM
[4:17:42] predictions subscriber JoGoBeans: You can see the art start to improve compared to the first episode 
[4:17:56] premium Tac_Kilala: Im glad Toonami came back and stayed ever since. I got so hyped when they did that one April fools joke and played an entire classic Saturday night block lmao 
[4:18:03] subscriber twitch-recap-2023 ocarina_boy: MOM NOOOO
[4:18:14] predictions vip artist-badge Guardison: zzooTrip stop saying his name 
[4:18:14] predictions vip GodliestCat64: MOOOOOOOM NOOOO
[4:18:15] premium hooligan_julian: MOOOM 
[4:18:18] vip uforgot: atamYada MOTHERRRR 
[4:18:19] moderator founder turbo Dragoneye77: Jerma chat is crying 
[4:18:19] predictions thedoodler303: NOOOO
[4:18:19] vip twitch-recap-2023 bruxisma: LUL
[4:18:21] moderator partner DesertP: MOTHERRR 
[4:18:22] moderator partner DesertP: NOOO 
[4:18:24] subscriber robotsnake: the audio there lol 
[4:18:24] KillerQ13: Grimmi energy 
[4:18:43] predictions subscriber twitch-recap-2023 Piyokopyo: hey wait stop dying 
[4:18:45] moderator founder turbo Dragoneye77: is he okay 
[4:18:47] moderator partner DesertP: take this... to the ICUP.. 
[4:19:01] bits-charity CptHungrySpy: UPS? 
[4:19:05] Bladestorm01: Take I'm to the UPDOG 
[4:19:06] hexam_project: literally html 
[4:19:13] predictions subscriber snosa: html spotted 
[4:19:26] predictions subscriber JoGoBeans: it's Cher 
[4:19:26] Takamatsu2: not the sea rats :(
[4:19:43] twitch-recap-2023 WheresColonelPopcorn: naycha 
[4:19:55] predictions subscriber twitch-recap-2023 Piyokopyo: greats8Bruh
[4:19:57] predictions subscriber JoGoBeans: pogonaSmug
[4:19:58] vip uforgot: atamSmg
[4:20:02] twitch-recap-2023 Merak_r: oh well, time to put a bullet in her 
[4:20:06] predictions vip artist-badge Guardison: Faye no 
[4:20:12] predictions vip GodliestCat64: ayanatSweat
[4:20:14] moderator founder turbo Dragoneye77: a bomb 
[4:20:14] predictions vip twitch-recap-2023 Korokun: Just remembered the end of this one 
[4:20:15] predictions subscriber JoGoBeans: monkaS
[4:20:23] predictions thedoodler303: monkaS
[4:20:26] vip afiddler: monkaS
[4:20:26] vip uforgot: return 
[4:20:28] twitch-recap-2023 Fireborn: sweatFrog
[4:20:30] twitch-recap-2023 WheresColonelPopcorn: @Korokun same 
[4:20:32] Takamatsu2: its like starfield junk loot 
[4:20:32] moderator founder turbo Dragoneye77: return to monke 
[4:20:37] vip twitch-recap-2023 bruxisma: oh my god. jc. its a bomb 
[4:20:44] Bladestorm01: the Ouranguman 
[4:20:48] subscriber twitch-recap-2023 ocarina_boy: BERMAD WHERE IS MOM 
[4:20:54] predictions vip artist-badge Guardison: BERMAD SHOW MOM 
[4:21:01] predictions vip GodliestCat64: WHERE'S MOM BERMAD
[4:21:07] vip uforgot: Weslet WHERE'S MOM 
[4:21:18] premium hooligan_julian: CatSpin <-- PEAK RAT INTELLIGENCE 
[4:21:19] predictions vip GodliestCat64: It must be fun just having something floating in front of you out in space 
[4:21:45] moderator founder turbo Dragoneye77: huh 
[4:21:50] vip premium plorf: i forget how did faye get out of the bathroom 
[4:21:52] KillerQ13: LUL
[4:21:56] Takamatsu2: LUL
[4:21:58] vip uforgot: atamStare
[4:21:58] vip premium plorf: i was lethaling the conpany 
[4:21:59] predictions thedoodler303: LUL
[4:22:03] vip Snudl: siskoBruh
[4:22:04] hexam_project: at least they are figuring out how to combat the eyeball shape issue that develops in freefall 
[4:22:06] vip subscriber twitch-recap-2023 Whats_Aleppo: limesGiggle
[4:22:06] predictions vip artist-badge Guardison: @plorf Jet let one arm free then she used a hair pin 
[4:22:09] predictions deworming_in_progress: @plorf she had a thingamabob 
[4:22:13] AnodyneVS: catJAMGF
[4:22:14] vip bits Jane_Inferno: LUL
[4:22:14] predictions subscriber JoGoBeans: catJAMM
[4:22:16] premium hooligan_julian: HYPERDRUMTIME
[4:22:17] vip premium plorf: o yeah 
[4:22:17] predictions vip twitch-recap-2023 squirrelcabinet: jarJAM
[4:22:20] predictions subscriber snosa: jarJAM
[4:22:23] vip twitch-recap-2023 bruxisma: catPls
[4:22:26] predictions subscriber snosa: slay 
[4:22:27] twitch-recap-2023 Fireborn: odoAWOOGA
[4:22:27] predictions thedoodler303: jarJAM
[4:22:27] predictions subscriber twitch-recap-2023 Piyokopyo: odoAWOOGA
[4:22:31] Bladestorm01: LUL
[4:22:34] subscriber robotsnake: odoAWOOGA
[4:22:35] predictions vip twitch-recap-2023 Korokun: She can thinga my bob 
[4:22:49] subscriber twitch-recap-2023 ocarina_boy: sweatFrogM
[4:22:52] DaWhatTheFox: veerus 
[4:23:04] hexam_project: even in xxxx the salary man has problems 
[4:23:05] predictions vip GodliestCat64: ayanatSweat Spike STOP 
[4:23:08] vip uforgot: sweatFrog o O ( sweatFrogM ) 
[4:23:09] premium Don_Savik: imagine being named Twinkle 
[4:23:09] predictions thedoodler303: monkaS
[4:23:13] predictions vip artist-badge Guardison: sweatFrogM SPIKE STOP 
[4:23:14] hexam_project: or in this case, the exec 
[4:23:15] twitch-recap-2023 WheresColonelPopcorn: plz no touchie 
[4:23:31] moderator founder turbo Dragoneye77: why is the transmission audio messed up 
[4:23:32] broadcaster turbo GreatSphynx: odoAWOOGA
[4:23:33] DaWhatTheFox: tity 
[4:23:34] predictions vip GodliestCat64: greats8Bermus
[4:23:34] twitch-recap-2023 Merak_r: odoAWOOGA
[4:23:35] subscriber twitch-recap-2023 ocarina_boy: greats8Bermus
[4:23:36] predictions subscriber JoGoBeans: EZ Clap
[4:23:36] predictions vip artist-badge Guardison: odoAWOOGA
[4:23:37] vip afiddler: BERMAN
[4:23:38] vip uforgot: odoAWOOGA
[4:23:38] vip bits Jane_Inferno: odoAWOOGA
[4:23:38] predictions subscriber snosa: BERMAN
[4:23:40] predictions thedoodler303: BERMUS
[4:23:40] DumboAKAwumbo: BERMAN
[4:23:41] predictions subscriber snosa: lol 
[4:23:41] DaWhatTheFox: lol 
[4:23:41] vip Snudl: dumbmo1Awooga
[4:23:43] AnodyneVS: picBust
[4:23:43] twitch-recap-2023 WolfzenSkiigh: picBust
[4:23:43] vip subscriber twitch-recap-2023 Whats_Aleppo: limesBlush
[4:23:44] premium hooligan_julian: LUL
[4:23:44] predictions vip artist-badge Guardison: it's artistic 
[4:23:44] KillerQ13: LUL
[4:23:44] predictions thedoodler303: picBust
[4:23:45] predictions subscriber twitch-recap-2023 Piyokopyo: why do they sound like the adobe audion enhancement shit 
[4:23:46] twitch-recap-2023 WheresColonelPopcorn: picBust
[4:23:47] whisperstatic: BERMAN
[4:23:48] Takamatsu2: LUL is that hentai or normal porn 
[4:23:49] subscriber robotsnake: BERMUS
[4:23:50] hexam_project: neopolitans banned 
[4:23:51] predictions subscriber snosa: picBust saved 
[4:23:53] nightlydonk: its okay she's had a double mastectomy 
[4:23:53] predictions subscriber JoGoBeans: it's okay no nipples 
[4:23:57] predictions subscriber twitch-recap-2023 n0tthedoctor: picBust
[4:24:01] Bladestorm01: BERMUS
[4:24:16] predictions vip twitch-recap-2023 Korokun: agga 
[4:24:17] predictions subscriber twitch-recap-2023 Piyokopyo: agga 
[4:24:21] predictions deworming_in_progress: gyattaca 
[4:24:25] predictions subscriber snosa: tagat catcgatacaaggctgactcg 
[4:24:27] vip premium plorf: return to monke 
[4:24:44] subscriber robotsnake: lacPanic
[4:24:44] vip artist-badge Raxxmus: lol 
[4:24:46] predictions vip GodliestCat64: lmao 
[4:24:46] predictions subscriber twitch-recap-2023 Piyokopyo: spike is just a monkey 
[4:24:47] predictions thedoodler303: monkaS STOP 
[4:24:50] subscriber twitch-recap-2023 ocarina_boy: sweatFrog
[4:24:51] AnodyneVS: catcatcat catPls
[4:24:53] twitch-recap-2023 WolfzenSkiigh: SPIKE there is a biohazard symbol on the ends of it pls 
[4:24:54] RohanFalcon: Not seeing that funny symbol for biohazard. 
[4:24:55] twitch-recap-2023 Merak_r: love this scene so much 
[4:25:07] predictions thedoodler303: tendiAAH
[4:25:10] predictions subscriber snosa: :0 
[4:25:17] predictions subscriber twitch-recap-2023 Piyokopyo: now eat it chewLes
[4:25:21] broadcaster turbo GreatSphynx: NOOOO
[4:25:22] subscriber twitch-recap-2023 ocarina_boy: TREKW
[4:25:26] predictions thedoodler303: TREKW
[4:25:30] vip uforgot: atamStare
[4:25:31] broadcaster turbo GreatSphynx: terrorists win counterstrike.wav 
[4:25:36] vip Snudl: odoKEK
[4:25:38] predictions subscriber snosa: lol 
[4:25:38] moderator founder turbo Dragoneye77: she looks like the evil ginger lady from grandma got run over by a reindeer but older and dyed hair 
[4:25:40] predictions vip GodliestCat64: Cool tube 
[4:25:40] predictions vip twitch-recap-2023 Korokun: I forgot these spiral airlocks 
[4:25:42] DaWhatTheFox: tp roll 
[4:25:43] vip uforgot: atamLew
[4:25:45] predictions vip twitch-recap-2023 Korokun: Those were really neat 
[4:25:46] whisperstatic: @wolfzenskiigh Spike's whole character essentially boils down to finding the coolest way to die 
[4:25:50] twitch-recap-2023 WheresColonelPopcorn: Chinese fingertrap 
[4:25:57] broadcaster turbo GreatSphynx: swooce 
[4:26:20] twitch-recap-2023 WolfzenSkiigh: @whisperstatic Oh I know I've seen the whole series lmfao 
[4:26:24] hexam_project: wait was that pl/i 
[4:26:46] predictions thedoodler303: monkaS
[4:26:48] predictions vip GodliestCat64: NOOOO
[4:26:48] predictions vip twitch-recap-2023 squirrelcabinet: tendiAAH
[4:26:49] subscriber twitch-recap-2023 ocarina_boy: NOOOO
[4:26:50] predictions subscriber twitch-recap-2023 Piyokopyo: MAMA NO WHY 
[4:26:50] DaWhatTheFox: he will become monky 
[4:26:51] predictions subscriber JoGoBeans: NOOOO
[4:26:51] broadcaster turbo GreatSphynx: catBlink
[4:26:52] vip afiddler: monkaS
[4:26:52] twitch-recap-2023 WheresColonelPopcorn: Politician speak does not impress her LUL
[4:26:53] predictions vip artist-badge Guardison: NOOOO
[4:26:54] predictions thedoodler303: NOOOO
[4:26:54] nightlydonk: iM vOiCe AcTiNG 
[4:27:02] predictions subscriber snosa: h! catBlink
[4:27:08] vip subscriber twitch-recap-2023 Whats_Aleppo: limesBlink
[4:27:13] predictions Origfx: catBlink
[4:27:25] moderator founder turbo Dragoneye77: merry christmas 
[4:27:33] predictions subscriber twitch-recap-2023 Piyokopyo: peepoHappy pretty 
[4:27:44] predictions subscriber snosa: ✨ 
[4:27:49] vip uforgot: i can read that now atamCozy
[4:28:27] vip uforgot: popCat
[4:28:36] predictions vip GodliestCat64: catBoom
[4:28:36] subscriber twitch-recap-2023 ocarina_boy: bUrself
[4:28:39] predictions vip artist-badge Guardison: peaceful btw 
[4:28:39] predictions subscriber snosa: catBoom
[4:28:39] predictions vip twitch-recap-2023 Korokun: I don't remember the original airing having this heavy filtering 
[4:28:40] predictions subscriber twitch-recap-2023 Piyokopyo: i really don't remember them sounding fucked like this on comms 
[4:28:40] predictions thedoodler303: catBoom
[4:28:52] predictions subscriber twitch-recap-2023 n0tthedoctor: Explosion
[4:28:55] predictions subscriber twitch-recap-2023 Piyokopyo: it literally sounds like the adobe enhancement 
[4:28:55] broadcaster turbo GreatSphynx: oog 
[4:28:58] subscriber robotsnake: catBoom
[4:28:58] predictions vip GodliestCat64: I forgot that was the virus name 
[4:28:59] RohanFalcon: No way. 
[4:28:59] moderator founder turbo Dragoneye77: return 
[4:29:00] Bladestorm01: SPACE IRA monkaS
[4:29:02] RohanFalcon: Return to monke! 
[4:29:05] AnodyneVS: vargDong
[4:29:14] nightlydonk: monke nuke 
[4:29:25] broadcaster turbo GreatSphynx: it might be something with this encode that i got idk, like a couple episodes have been fine and some arent 
[4:29:28] premium Don_Savik: did cowboy bebop invent returning to monke? 
[4:29:32] broadcaster turbo GreatSphynx: or maybe they redid the effects for the blu ray i have no idea 
[4:29:34] DaWhatTheFox: and they pay with bananas 
[4:29:37] moderator founder turbo Dragoneye77: NOO 
[4:29:39] predictions vip artist-badge Guardison: D:
[4:29:39] moderator founder turbo Dragoneye77: FREE HIM 
[4:29:41] predictions subscriber snosa: D:
[4:29:44] predictions thedoodler303: D; 
[4:29:45] predictions subscriber twitch-recap-2023 Piyokopyo: NOOOO EIN 
[4:29:46] vip subscriber twitch-recap-2023 Whats_Aleppo: limesSob
[4:29:48] predictions thedoodler303: D:
[4:29:49] Takamatsu2: LUL dumb corgi 
[4:29:51] twitch-recap-2023 WheresColonelPopcorn: do not be mean to doggo 
[4:29:52] vip DarkFlame7755: yeah the blu ray is infamously different in the audio 
[4:29:53] broadcaster turbo GreatSphynx: catJAM catJAM catJAM catJAM catJAM
[4:29:56] predictions vip artist-badge Guardison: catJAM
[4:29:56] predictions subscriber JoGoBeans: catPls
[4:29:57] predictions vip GodliestCat64: catJAM
[4:29:59] vip premium plorf: catPls
[4:30:00] premium hooligan_julian: catPls
[4:30:01] vip twitch-recap-2023 bruxisma: catJAM
[4:30:01] predictions thedoodler303: catJAM
[4:30:02] broadcaster turbo GreatSphynx: oh well my bad 
[4:30:02] predictions vip twitch-recap-2023 Korokun: I would've guessed a bad remastering situation 
[4:30:02] DaWhatTheFox: funnywhitecat5
[4:30:03] subscriber twitch-recap-2023 ocarina_boy: catPls
[4:30:03] predictions subscriber twitch-recap-2023 Piyokopyo: catJAM
[4:30:04] predictions subscriber snosa: quarkDance quarkDance quarkDance
[4:30:04] vip twitch-recap-2023 bruxisma: catPls
[4:30:05] moderator founder turbo Dragoneye77: vargDuane
[4:30:05] subscriber robotsnake: catPls
[4:30:07] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM greats8JAM greats8JAM
[4:30:08] vip twitch-recap-2023 bruxisma: jarJAM
[4:30:10] vip artist-badge Raxxmus: jarJAM
[4:30:11] Bladestorm01: DinoDance DinoDance DinoDance
[4:30:14] AnodyneVS: catJAM DrumTime BAND ASSEMBLE 
[4:30:14] hexam_project: nge parody almost 
[4:30:14] vip DarkFlame7755: Some people prefer the blu ray but not purists 
[4:30:17] twitch-recap-2023 Merak_r: NESSIE
[4:30:18] vip twitch-recap-2023 viahate: Yeat Yeat Yeat
[4:30:20] predictions vip GodliestCat64: greats8YoTrip
[4:30:21] twitch-recap-2023 WheresColonelPopcorn: DinoDance DinoDance DinoDance
[4:30:31] predictions subscriber snosa: ah shit 
[4:30:33] broadcaster turbo GreatSphynx: i wouldnt be able to tell a difference unless i had the other version on my computer and i dont 
[4:30:36] moderator founder turbo Dragoneye77: god spikes ship is so cool 
[4:30:52] twitch-recap-2023 WheresColonelPopcorn: Everything sounds fine to me 
[4:30:56] predictions vip twitch-recap-2023 squirrelcabinet: HUHH
[4:30:56] Bladestorm01: the Elongate canon 
[4:31:08] broadcaster turbo GreatSphynx: yeah i think its fine, one episode everything sounded like it was in a tube but thats just been 1 
[4:31:08] AnodyneVS: catJAM SaxTime
[4:31:10] moderator founder turbo Dragoneye77: the transmission audio doesnt sound like this usually 
[4:31:13] moderator founder turbo Dragoneye77: its not a big deal tbh 
[4:31:19] nightlydonk: the mixing sounds a lil off 
[4:31:28] predictions vip twitch-recap-2023 squirrelcabinet: catBoom
[4:31:30] predictions thedoodler303: catJAM SaxTime
[4:31:30] predictions subscriber snosa: WHAT
[4:31:35] predictions subscriber twitch-recap-2023 Piyokopyo: tendiAAH
[4:31:36] predictions subscriber JoGoBeans: wideVIBE
[4:31:40] RohanFalcon: Fragment to fragments. 
[4:31:43] vip subscriber twitch-recap-2023 Whats_Aleppo: limesS
[4:31:53] predictions vip GodliestCat64: ayanatSweat
[4:31:55] subscriber robotsnake: lacPanic
[4:32:04] nightlydonk: catScream
[4:32:08] vip uforgot: atamRe
[4:32:11] moderator founder turbo Dragoneye77: in hindsight closing the gate seems like the logical first thing to do 
[4:32:25] predictions subscriber JoGoBeans: space hole closed 
[4:32:31] predictions vip GodliestCat64: holePls
[4:32:32] premium Frakassous: EZ Clap
[4:32:32] predictions subscriber snosa: holePls
[4:32:35] subscriber twitch-recap-2023 ocarina_boy: holePls
[4:32:35] vip uforgot: holePls
[4:32:42] vip premium plorf: they had to wait for the govt to close it 
[4:32:45] predictions subscriber twitch-recap-2023 Piyokopyo: ghost missiles greats8YoTrip
[4:32:47] predictions subscriber JoGoBeans: jmikeNoted
[4:32:49] broadcaster turbo GreatSphynx: zzooTrip
[4:32:58] AnodyneVS: jmikeNoted
[4:33:00] subscriber twitch-recap-2023 ocarina_boy: tendiAAH
[4:33:00] vip afiddler: wideHUH
[4:33:04] predictions vip artist-badge Guardison: cinderThumb
[4:33:06] moderator founder turbo Dragoneye77: its joever 
[4:33:08] predictions subscriber twitch-recap-2023 Piyokopyo: sweatFrogM
[4:33:08] subscriber twitch-recap-2023 ocarina_boy: NOOOO
[4:33:10] vip uforgot: return 
[4:33:10] vip artist-badge Raxxmus: closing the gate was a financial burden 
[4:33:11] vip uforgot: to 
[4:33:11] vip premium plorf: NOOOO
[4:33:12] predictions thedoodler303: NOOOO
[4:33:13] vip uforgot: monke 
[4:33:15] nightlydonk: osmoStare
[4:33:16] predictions vip GodliestCat64: TREKW
[4:33:16] subscriber robotsnake: lacPanic lacPanic lacPanic lacPanic lacPanic
[4:33:17] Takamatsu2: LUL
[4:33:19] vip Snudl: TREKW
[4:33:20] twitch-recap-2023 Merak_r: odoKEK
[4:33:20] RohanFalcon: Sleight of hand, damn. 
[4:33:23] predictions thedoodler303: TREKW
[4:33:26] subscriber twitch-recap-2023 ocarina_boy: 🦧 
[4:33:32] vip subscriber twitch-recap-2023 Whats_Aleppo: limesGiggle
[4:33:34] twitch-recap-2023 WheresColonelPopcorn: monke'd 
[4:33:37] vip premium lmaoboat: BERMAN
[4:33:37] premium hooligan_julian: TREKW
[4:33:50] moderator founder turbo Dragoneye77: shes using OUR hot water 
[4:33:51] predictions thedoodler303: LUL
[4:33:54] moderator founder turbo Dragoneye77: shes not paying rent 
[4:33:57] subscriber twitch-recap-2023 ocarina_boy: pissing in MY sink 
[4:34:00] vip premium lmaoboat: Seems that way. 
[4:34:01] twitch-recap-2023 WheresColonelPopcorn: uhoh 
[4:34:03] predictions subscriber twitch-recap-2023 Piyokopyo: dead 
[4:34:04] predictions vip artist-badge Guardison: TREKW
[4:34:05] vip artist-badge Raxxmus: wow dead 
[4:34:06] broadcaster turbo GreatSphynx: searat 
[4:34:07] predictions vip GodliestCat64: lmao 
[4:34:08] moderator founder turbo Dragoneye77: hes dead 
[4:34:09] subscriber dumbmoths: end of show spike is dead 
[4:34:10] broadcaster turbo GreatSphynx: catJAMGF
[4:34:10] moderator founder turbo Dragoneye77: final episode 
[4:34:11] predictions vip GodliestCat64: wideVIBE
[4:34:12] vip uforgot: spiko 
[4:34:13] Tiphias: bang 
[4:34:13] predictions subscriber snosa: see u space cowboy.... 
[4:34:13] predictions vip twitch-recap-2023 squirrelcabinet: catJamrgb
[4:34:14] nightlydonk: Mag dumping in the shower 
[4:34:14] predictions subscriber twitch-recap-2023 Piyokopyo: catJAMPARTY
[4:34:14] predictions subscriber JoGoBeans: wideVIBE
[4:34:14] DaWhatTheFox: wideVIBE wideVIBE
[4:34:15] predictions vip artist-badge Guardison: wideVIBE
[4:34:15] subscriber dumbmoths: catPls
[4:34:16] twitch-recap-2023 Fireborn: VIBE
[4:34:16] predictions thedoodler303: catJAMGF
[4:34:17] subscriber twitch-recap-2023 ocarina_boy: catJammingPolitely Clap
[4:34:17] predictions subscriber snosa: wideVIBE
[4:34:20] subscriber premium Yeven_Fox: wideVIBE
[4:34:22] vip twitch-recap-2023 bruxisma: catJAMM
[4:34:22] superultracombo-2023 Left_Justified: PepePls
[4:34:22] twitch-recap-2023 WheresColonelPopcorn: Clap
[4:34:23] predictions vip twitch-recap-2023 Korokun: Can't believe they killed off Spike off-screen 
[4:34:24] vip subscriber twitch-recap-2023 Whats_Aleppo: VIBE
[4:34:25] predictions deworming_in_progress: Funnywhitecat5 TrumpetTime
[4:34:26] vip uforgot: mag would upperdecker ngl 
[4:34:26] vip Snudl: wideVIBE
[4:34:28] nightlydonk: wideVIBE
[4:34:28] Bladestorm01: Clap
[4:34:35] vip twitch-recap-2023 viahate: catJAMGF catJAMGF
[4:34:40] predictions thedoodler303: wideVIBE
[4:34:41] subscriber dumbmoths: i forgot just how fun this show was 
[4:34:54] broadcaster turbo GreatSphynx: catJAM
[4:34:57] predictions vip GodliestCat64: wideVIBE THE REAL FOOOOLK BLUUUUEEES wideVIBE
[4:35:00] moderator founder turbo Dragoneye77: vargDuane THE REAL 
[4:35:00] vip premium plorf: VIBE
[4:35:01] predictions subscriber twitch-recap-2023 Piyokopyo: wideVIBE
[4:35:03] Bladestorm01: rip spike He truly was space cowboy 
[4:35:03] predictions vip twitch-recap-2023 squirrelcabinet: chatPls
[4:35:07] predictions vip artist-badge Guardison: wideVIBE
[4:35:11] premium Tac_Kilala: THE REAL fooolk bloooos 
[4:35:13] predictions subscriber snosa: wideVIBE wideVIBE wideVIBE
[4:35:14] vip uforgot: Nanny Nanny Nanny Nanni
[4:35:15] premium nickynack: wideVIBE
[4:35:21] moderator founder turbo Dragoneye77: at least spike was able to gongo one nut before dying 
[4:35:23] moderator partner DesertP: NESSIE
[4:35:24] vip premium lmaoboat: I like shows that are mostly just fun 
[4:35:47] vip uforgot: (toys in the attic) 
[4:35:49] DaWhatTheFox: wideVIBE
[4:35:51] broadcaster turbo GreatSphynx: widepeepoSad
[4:35:51] vip artist-badge Raxxmus: we should watch one episode of netflix bebop 
[4:35:52] AnodyneVS: jmikeSadbungle
[4:35:52] moderator founder turbo Dragoneye77: yeah 
[4:35:53] vip premium plorf: greats8YoTrip
[4:35:53] predictions vip artist-badge Guardison: monkaS
[4:35:53] vip artist-badge Raxxmus: for fun 
[4:35:54] vip artist-badge Raxxmus: :)
[4:35:54] moderator founder turbo Dragoneye77: good fun 
[4:35:54] predictions vip GodliestCat64: greats8YoTrip
[4:35:59] predictions subscriber JoGoBeans: amazing episode is next OYOTrip
[4:35:59] predictions thedoodler303: monkaS
[4:36:00] twitch-recap-2023 Fireborn: OTrip this one 
[4:36:03] predictions subscriber twitch-recap-2023 Piyokopyo: catJammingPolitely
[4:36:09] twitch-recap-2023 WheresColonelPopcorn: Iconic episode 
[4:36:09] subscriber robotsnake: atpFeelsBeardMan Oh an episode part of the main story 
[4:36:14] vip SCP096: 🧅 
[4:36:19] predictions vip artist-badge Guardison: odoNo
[4:36:19] predictions vip twitch-recap-2023 Korokun: I forgot that episode was so early 
[4:36:19] subscriber twitch-recap-2023 ocarina_boy: Clap
[4:36:22] predictions subscriber JoGoBeans: That's the episode where the animation just decides to take a huge leap in quality 
[4:36:22] predictions subscriber snosa: Clap
[4:36:22] broadcaster turbo GreatSphynx: !break 
[4:36:22] moderator partner Nightbot: It's time for a break, don't go away. 3min of ads will play so you don't have to see any ads for the next hour. Otherwise chill and enjoy the music. 
[4:36:23] predictions vip GodliestCat64: Clap
[4:36:25] Blocknight1: Clap
[4:36:26] vip SCP096: Clap
[4:36:26] predictions thedoodler303: Clap
[4:36:27] DumboAKAwumbo: longo OYOTrip
[4:36:27] superultracombo-2023 Left_Justified: atpFeelsBeardMan Clap
[4:36:29] vip Snudl: AngelThump
[4:36:30] predictions subscriber twitch-recap-2023 n0tthedoctor: Clap
[4:36:32] vip subscriber twitch-recap-2023 Whats_Aleppo: Clap
[4:36:33] vip twitch-recap-2023 viahate: Clap
[4:36:36] predictions subscriber snosa: hapiCat
[4:36:36] DaWhatTheFox: catJAMGF catJAMGF catJAMGF
[4:36:37] moderator founder turbo Dragoneye77: @GreatSphynx are you going do the next part after the break or nah 
[4:36:38] predictions subscriber JoGoBeans: catPls
[4:36:39] moderator partner DesertP: into the gongoverse 
[4:36:43] predictions vip twitch-recap-2023 Korokun: The classic budget dump episode 
[4:36:43] vip twitch-recap-2023 viahate: quarkPls quarkPls quarkPls
[4:36:44] cheapsushidragon: catJAMM catJAMM catJAMM catJAMM
[4:36:46] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM greats8JAM greats8JAM
[4:36:46] vip premium plorf: greats8YoTrip
[4:36:51] predictions subscriber snosa: quarkDance quarkDance quarkDance
[4:36:52] superultracombo-2023 Left_Justified: catPls catPls catPls
[4:36:54] vip premium plorf: catPls
[4:36:54] predictions subscriber JoGoBeans: @Dragoneye77 Sphynx likes to blueball 
[4:36:55] broadcaster turbo GreatSphynx: no im just doing those 2 episodes 
[4:36:56] predictions thedoodler303: catJAMM catJAMM catJAMM
[4:36:57] predictions subscriber twitch-recap-2023 n0tthedoctor: IF YOU WANNA DANCE TONIGHT 
[4:37:00] moderator founder turbo Dragoneye77: kk 
[4:37:00] Rooks_Castle: catPls
[4:37:02] vip afiddler: catJamrgb
[4:37:03] sub-gifter NastyRedX: PartyParrot PartyParrot PartyParrot
[4:37:05] twitch-recap-2023 WheresColonelPopcorn: sandecWiggle sandecWiggle sandecWiggle
[4:37:09] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE
[4:37:11] twitch-recap-2023 WheresColonelPopcorn: Powerful slappin bass 
[4:37:14] vip uforgot: kirkBASS eGuitarTime
[4:37:16] DaWhatTheFox: catJAMPARTY
[4:37:20] predictions subscriber snosa: catPls catPls catPls
[4:37:22] vip twitch-recap-2023 bruxisma: Sleepo i can't stay awake any longer. night gongo
[4:37:25] predictions subscriber twitch-recap-2023 n0tthedoctor: catJAMGF
[4:37:26] predictions vip twitch-recap-2023 squirrelcabinet: Funnywhitecat5
[4:37:33] broadcaster turbo GreatSphynx: Pepechill eGuitarTime
[4:37:41] moderator partner DesertP: night brux 
[4:37:41] broadcaster turbo GreatSphynx: night 
[4:37:44] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8SPRIGGLE greats8JAM greats8SPRIGGLE greats8JAM greats8SPRIGGLE greats8JAM greats8SPRIGGLE greats8JAM
[4:37:45] vip Snudl: @bruxisma Sleepo Good night 
[4:37:56] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM greats8JAM
[4:37:59] predictions subscriber snosa: quarkDance quarkDance quarkDance
[4:38:07] glhf-pledge empanadas_in_pinatas: thanks for the tasty jams 
[4:38:24] predictions thedoodler303: @bruxisma Good night jmikeMask
[4:38:50] moderator founder turbo Dragoneye77: chat 
[4:38:58] predictions vip GodliestCat64: Corb
[4:38:58] moderator founder turbo Dragoneye77: is it a bad idea to microwave bagels 
[4:39:02] predictions vip GodliestCat64: Yeah 
[4:39:03] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8SPRIGGLE greats8JAM greats8SPRIGGLE greats8SPRIGGLE greats8JAM
[4:39:03] subscriber glitchcon2020 LnLessa: longo 
[4:39:04] predictions vip GodliestCat64: They get hard 
[4:39:10] twitch-recap-2023 Fireborn: holy catJAMM eGuitarTime
[4:39:23] predictions vip GodliestCat64: You'd be better off eating it as is then in the microwave 
[4:39:25] superultracombo-2023 Left_Justified: BBoomer eGuitarTime
[4:39:25] moderator founder turbo Dragoneye77: but theyre already hard they were in the fridge 
[4:39:37] predictions subscriber snosa: oh shit 
[4:39:41] predictions subscriber twitch-recap-2023 n0tthedoctor: 80s Japan has a lot of bangers 
[4:39:43] predictions subscriber snosa: catJAM SaxTime
[4:39:57] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM greats8JAM
[4:40:03] moderator partner DesertP: soak the bagel 
[4:40:06] predictions vip twitch-recap-2023 Korokun: Maybe you can steam them in the microwave 
[4:40:08] moderator partner DesertP: to unharden the bagel 
[4:40:26] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE
[4:40:43] broadcaster turbo GreatSphynx: wrap it in a sorta damp paper towel and microwave it for like 15 seconds at a time 
[4:40:46] glhf-pledge empanadas_in_pinatas: rebeck6JAM rebeck6JAM rebeck6JAM rebeck6JAM
[4:40:56] sub-gifter NastyRedX: real 
[4:40:58] Kestrel707: on plate, sprinkle water, cover with paper towel 15-25 secs 
[4:41:00] broadcaster turbo GreatSphynx: like wrap it and then wring it out 
[4:41:03] DaWhatTheFox: meowJAMJAM
[4:41:07] broadcaster turbo GreatSphynx: or soak it then wring it i mean 
[4:41:08] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM greats8JAM
[4:41:10] predictions vip twitch-recap-2023 Korokun: I forget what I've used that trick on before 
[4:41:22] DaWhatTheFox: wideVIBE
[4:41:25] predictions subscriber snosa: wideVIBE
[4:41:25] vip premium plorf: whats wrong with microwaving bread 
[4:41:27] sub-gifter NastyRedX: that makes microwave burritos way better 
[4:41:28] predictions thedoodler303: wideVIBE
[4:41:28] vip premium plorf: i do it all the time 
[4:41:30] broadcaster turbo GreatSphynx: it works for tortillas and lots of stuff 
[4:41:31] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM
[4:41:36] broadcaster turbo GreatSphynx: if you microwave it for too long it gets tough 
[4:41:42] predictions subscriber twitch-recap-2023 n0tthedoctor: More Toshiki greats8Happi greats8Happi greats8Happi
[4:41:43] broadcaster turbo GreatSphynx: and if its too dry it will just get hard 
[4:41:45] predictions vip GodliestCat64: I've never thought of doing that tbh monkey brain is just like 
[4:41:45] vip premium plorf: ok well dont microwave it too long 
[4:41:48] vip premium plorf: greats8Bruh
[4:41:49] predictions vip GodliestCat64: picBust bread will warm 
[4:42:08] subscriber premium Fecal_Sauce: mrfecalsauce66 subscribed at Tier 1. 
[4:42:11] moderator founder turbo Dragoneye77: i didnt see anything you guys said 
[4:42:14] broadcaster turbo GreatSphynx: in general creating a steamy environment in the microwave to reheat is what you want with most starch based things 
[4:42:16] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Daxmug
[4:42:17] moderator founder turbo Dragoneye77: i microwaves my bagels anyway 
[4:42:18] broadcaster turbo GreatSphynx: like pasta you want more sauce 
[4:42:23] moderator founder turbo Dragoneye77: theyre nice and hot now 
[4:42:24] broadcaster turbo GreatSphynx: or like rice add some water 
[4:42:31] vip afiddler: wideVIBE
[4:42:39] predictions subscriber twitch-recap-2023 n0tthedoctor: wideVIBE
[4:42:50] twitch-recap-2023 Fireborn: wideVIBE
[4:43:07] predictions subscriber snosa: Pepechill
[4:43:26] moderator founder turbo Dragoneye77: greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE
[4:43:40] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8SPRIGGLE greats8JAM
[4:44:02] broadcaster turbo GreatSphynx: spynxHappi
[4:44:07] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM SaxTime
[4:44:11] broadcaster turbo GreatSphynx: osmo still asleep on th e floor 
[4:44:13] broadcaster turbo GreatSphynx: towel 
[4:44:18] predictions subscriber snosa: lol 
[4:44:20] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Osmopat
[4:44:25] broadcaster turbo GreatSphynx: guess the desk was too noisy for him tonight 
[4:44:25] predictions subscriber twitch-recap-2023 n0tthedoctor: SaxTime
[4:44:32] predictions subscriber snosa: greats8Osmopat
[4:44:32] predictions thedoodler303: osmoPat
[4:44:33] predictions vip GodliestCat64: osmoPat
[4:44:37] dilly393: osmoPat
[4:44:40] broadcaster turbo GreatSphynx: or maybe hes mad because all day hes been climbing up on the gongo gear and i keep picking him up and putting him on his tree or the desk 
[4:44:41] predictions subscriber snosa: aaa 
[4:44:47] predictions subscriber twitch-recap-2023 n0tthedoctor: AAAA 
[4:44:52] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE greats8SPRIGGLE
[4:44:56] moderator founder turbo Dragoneye77: i really hope osmo doesnt intterupt the stream for the 5th time 
[4:45:02] moderator founder turbo Dragoneye77: it would be really funny with the current bet odds 
[4:45:02] broadcaster turbo GreatSphynx: i dont think hes gonna 
[4:45:10] broadcaster turbo GreatSphynx: hes been doing it all day 
[4:45:11] steve_airport: entranced by the glorious gongo machine 
[4:45:12] broadcaster turbo GreatSphynx: so its out of his system 
[4:45:15] predictions subscriber snosa: subdued by damp towel 
[4:45:23] broadcaster turbo GreatSphynx: DIESOFCRINGE
[4:45:29] predictions vip GodliestCat64: noBrien I bet all my quats 
[4:45:30] predictions subscriber twitch-recap-2023 Piyokopyo: NOOOO my quats 
[4:45:33] predictions thedoodler303: What is the songs name? 
[4:45:37] twitch-recap-2023 WolfzenSkiigh: Bloodlust sated... for now osmoLick
[4:45:38] predictions subscriber JoGoBeans: OYTrip
[4:45:39] DumboAKAwumbo: OYTrip
[4:45:41] predictions vip GodliestCat64: OYTrip
[4:45:42] predictions subscriber snosa: OYTrip
[4:45:43] predictions subscriber twitch-recap-2023 Piyokopyo: greats8Ytrip
[4:45:43] predictions thedoodler303: OYTrip
[4:45:43] broadcaster turbo GreatSphynx: midnight girl by toshiki kadomatsu 
[4:45:45] subscriber dumbmoths: OYTrip
[4:45:48] predictions thedoodler303: @GreatSphynx ty 
[4:45:59] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Ytrip
[4:46:01] DaWhatTheFox: OYOTrip
[4:46:02] Kestrel707: OYOTrip
[4:46:03] predictions subscriber JoGoBeans: OYOTrip
[4:46:03] predictions vip GodliestCat64: Omo greats8YoTrip
[4:46:04] moderator founder turbo Dragoneye77: OSMO
[4:46:04] predictions subscriber twitch-recap-2023 Piyokopyo: carlPog
[4:46:05] predictions subscriber snosa: OYOTrip
[4:46:05] vip premium plorf: osmo 
[4:46:06] predictions thetwitch3r: carlPog
[4:46:06] vip twitch-recap-2023 viahate: greats8YoTrip
[4:46:07] predictions vip twitch-recap-2023 squirrelcabinet: carlPog
[4:46:07] vip DarkFlame7755: greats8YoTrip osmo 
[4:46:09] predictions vip twitch-recap-2023 squirrelcabinet: catJammingPolitely
[4:46:10] predictions subscriber snosa: OSMO
[4:46:11] vip subscriber twitch-recap-2023 Whats_Aleppo: limesPoggers
[4:46:11] vip Snudl: carlPog
[4:46:12] grandfatigue: osmoD
[4:46:14] vip afiddler: carlPog
[4:46:14] moderator founder turbo Dragoneye77: !lore 
[4:46:15] moderator partner Nightbot: https://i.imgur.com/M9p7Vxl.png 
[4:46:16] subscriber twitch-recap-2023 ocarina_boy: osmoBlep
[4:46:18] predictions vip twitch-recap-2023 Korokun: OSMO LORE 
[4:46:19] predictions subscriber snosa: osmoD <-- 
[4:46:19] steve_airport: C S 
[4:46:19] predictions subscriber twitch-recap-2023 Piyokopyo: greats8Osmopat
[4:46:19] predictions vip twitch-recap-2023 squirrelcabinet: said it carlPog
[4:46:21] vip yourdaffypal: i love this show 
[4:46:21] predictions vip GodliestCat64: OSMO
[4:46:21] moderator founder turbo Dragoneye77: lol 
[4:46:24] predictions subscriber snosa: hehe 
[4:46:24] subscriber robotsnake: OSMO
[4:46:24] predictions thedoodler303: OYOTrip OSMO
[4:46:26] vip bits Jane_Inferno: OSMO
[4:46:27] subscriber dumbmoths: O S M O 
[4:46:28] grandfatigue: LUL
[4:46:28] vip afiddler: osmoLick
[4:46:30] moderator founder turbo Dragoneye77: sphynx did you edit that yourself 
[4:46:30] DumboAKAwumbo: osmoD
[4:46:31] vip artist-badge Raxxmus: osmoBlep
[4:46:34] vip twitch-recap-2023 viahate: osmoD
[4:46:41] broadcaster turbo GreatSphynx: no it defaults to the spanish dub 
[4:46:45] predictions subscriber twitch-recap-2023 Piyokopyo: that's just how it is in the show 
[4:46:46] moderator founder turbo Dragoneye77: lol 
[4:46:52] twitchcon2017 RossTB: by Carlos Danger 
[4:46:55] predictions vip twitch-recap-2023 Korokun: Oh I thought you just played something else on top 
[4:46:55] moderator founder turbo Dragoneye77: !osmolore 
[4:46:55] moderator partner Nightbot: https://twitter.com/Great_Sphynx/status/1704616824196002099 
[4:46:57] predictions subscriber JoGoBeans: zzooTrip PianoTime
[4:47:10] superultracombo-2023 Left_Justified: BeanieHipster
[4:47:12] predictions subscriber snosa: gleebyDeeby
[4:47:16] predictions subscriber twitch-recap-2023 Piyokopyo: beans 
[4:47:16] grandfatigue: gongoCrystal
[4:47:21] budderdog_: zzooTrip gleebyDeeby
[4:47:26] predictions subscriber twitch-recap-2023 Piyokopyo: wideHUH
[4:47:27] predictions subscriber JoGoBeans: what 
[4:47:27] moderator founder turbo Dragoneye77: hmm 
[4:47:28] predictions subscriber twitch-recap-2023 n0tthedoctor: The BEANS 
[4:47:29] predictions subscriber snosa: zzooTrip
[4:47:29] DaWhatTheFox: monkaSphynx
[4:47:29] predictions thedoodler303: HUHH
[4:47:30] moderator founder turbo Dragoneye77: si 
[4:47:30] premium explec0: LUL
[4:47:32] vip artist-badge Raxxmus: wweird carl 
[4:47:33] DumboAKAwumbo: TREKW
[4:47:35] bits-charity CptHungrySpy: Por que? 
[4:47:36] vip Snudl: TREKW
[4:47:36] predictions subscriber twitch-recap-2023 n0tthedoctor: LUL
[4:47:37] predictions deworming_in_progress: osmo en español 
[4:47:38] Takamatsu2: la via lactea needTrip
[4:47:38] subscriber twitch-recap-2023 ocarina_boy: bien 
[4:47:39] grandfatigue: carlPog
[4:47:40] predictions thedoodler303: LUL
[4:47:43] predictions subscriber JoGoBeans: jaja chat no entiende espanol TREKW
[4:47:43] predictions subscriber twitch-recap-2023 Piyokopyo: yo no hablo espanol por favor 
[4:47:45] vip premium plorf: lol 
[4:47:54] broadcaster turbo GreatSphynx: for some reason the version i have is spanish and english 
[4:47:59] predictions vip twitch-recap-2023 Korokun: THose are some real old style subs 
[4:48:02] broadcaster turbo GreatSphynx: and the spanish dub was like recorded in 1980 or something 
[4:48:09] vip premium lmaoboat: Sorry sir, just a little bit of Aphasia Virus sir noBrien
[4:48:09] Bladestorm01: el Osmo 
[4:48:13] broadcaster turbo GreatSphynx: oh yeah my kmplayer subs are like vhs subs 
[4:48:15] predictions thedoodler303: @GreatSphynx LUL Is it going to keep switching back and forth 
[4:48:17] broadcaster turbo GreatSphynx: i just rarely ever use them 
[4:48:19] bits-charity CptHungrySpy: Batching worlds 
[4:48:20] broadcaster turbo GreatSphynx: no i just did that for fun 
[4:48:28] predictions subscriber twitch-recap-2023 n0tthedoctor: Based
[4:48:35] predictions subscriber snosa: :3 
[4:48:45] broadcaster turbo GreatSphynx: i can leave subs on if you want but idc 
[4:48:55] broadcaster turbo GreatSphynx: zzooTrip
[4:48:57] predictions subscriber twitch-recap-2023 n0tthedoctor: gatorbGawe
[4:49:01] predictions bits nyeaszel: is it osmo's bday rn 
[4:49:06] twitch-recap-2023 Fireborn: zzooTrip WeedTime
[4:49:07] subscriber twitch-recap-2023 ocarina_boy: carlPog
[4:49:11] broadcaster turbo GreatSphynx: it was his half birthday yesterday 
[4:49:14] vip artist-badge Raxxmus: clement is a good word 
[4:49:20] predictions bits nyeaszel: ohhhh ok ok 
[4:49:24] predictions subscriber twitch-recap-2023 Piyokopyo: FeelsBirthdayMan
[4:49:26] predictions bits nyeaszel: hap half birth osmo 
[4:49:26] broadcaster turbo GreatSphynx: 6 mo old big baby 
[4:49:35] subscriber twitch-recap-2023 ocarina_boy: greats8Osmopat
[4:49:38] predictions subscriber twitch-recap-2023 Piyokopyo: lonely bean greats8OdoNo
[4:49:39] broadcaster turbo GreatSphynx: damp towel baby 
[4:49:40] Bladestorm01: who's clement? 
[4:49:49] predictions subscriber snosa: greats8Osmopat
[4:49:50] predictions bits nyeaszel: zzooTrip
[4:50:02] predictions vip twitch-recap-2023 squirrelcabinet: osmoPat
[4:50:06] predictions subscriber snosa: that's us 
[4:50:11] predictions bits nyeaszel: osmoPat
[4:50:11] subscriber twitch-recap-2023 ocarina_boy: our pale blue dot greats8ZooTrip
[4:50:11] Bladestorm01: OsmoPat 
[4:50:13] vip subscriber twitch-recap-2023 Whats_Aleppo: greats8JAM
[4:50:13] vip artist-badge Raxxmus: damp and sticky boy 
[4:50:17] vip subscriber twitch-recap-2023 Whats_Aleppo: greats8Osmopat
[4:50:19] twitch-recap-2023 Annonn140: this sounds like stellaris soundrack lol, i wonder if they were inspired by it 
[4:50:30] Bladestorm01: osmoPat
[4:50:38] vip artist-badge Raxxmus: I think most of the soundtrack for this show is just classical pieces 
[4:50:42] subscriber twitch-recap-2023 ocarina_boy: yeah carl was a huge fan of stellaris 
[4:50:55] broadcaster turbo GreatSphynx: 🦀 
[4:50:56] Bladestorm01: Well know fact 
[4:50:57] twitch-recap-2023 Annonn140: yeah but this sinth sounds 
[4:50:58] predictions bits nyeaszel: carlPog yumans 
[4:51:03] vip artist-badge Raxxmus: love this one 
[4:51:04] sub-gifter NastyRedX: carllaris 
[4:51:09] twitch-recap-2023 Annonn140: i mean the game Stellaris btw 
[4:51:12] subscriber twitch-recap-2023 ocarina_boy: literal baby 
[4:51:26] broadcaster turbo GreatSphynx: a lot of this soundtrack is vangelis and uh someone else i forget 
[4:51:40] vip premium lmaoboat: Are those pro genjis? 
[4:51:43] subscriber twitch-recap-2023 ocarina_boy: tendiAAH
[4:51:47] DumboAKAwumbo: FISHWAR
[4:52:05] sub-gifter NastyRedX: tendiAAH
[4:52:07] broadcaster turbo GreatSphynx: theres some tomita too 
[4:52:11] vip premium plorf: NOOOO
[4:52:11] broadcaster turbo GreatSphynx: http://cosmic_voyager.tripod.com/cosmosindex.htm 
[4:52:16] broadcaster turbo GreatSphynx: good website 
[4:52:17] Bladestorm01: HE NEED HEALING 
[4:52:19] twitch-recap-2023 WolfzenSkiigh: Oh man Vengelis is so good 
[4:52:24] broadcaster turbo GreatSphynx: and a lot of classical 
[4:52:29] steve_airport: A giant enemy crab appeared 
[4:52:31] broadcaster turbo GreatSphynx: like shostakovich and strvinsky and orft and holst 
[4:52:43] twitch-recap-2023 Annonn140: this site hurts my eyes 
[4:52:48] sub-gifter NastyRedX: lady nee OYOTrip
[4:53:02] Bladestorm01: they threw off the cliff 
[4:53:08] subscriber twitch-recap-2023 ocarina_boy: 🙏 
[4:53:20] subscriber twitch-recap-2023 ocarina_boy: o7
[4:53:21] vip premium lmaoboat: Drown in the place that you are, and face west 
[4:53:31] predictions subscriber twitch-recap-2023 Piyokopyo: blub blub 
[4:53:37] predictions subscriber snosa: peepoSad
[4:53:38] predictions bits nyeaszel: odoNo
[4:53:45] subscriber twitch-recap-2023 ocarina_boy: it's ok they went to atlantis 
[4:53:50] predictions subscriber snosa: oh ok 
[4:53:59] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8OdoNo
[4:54:10] subscriber robotsnake: atpFeelsBeardMan
[4:54:13] vip bits Jane_Inferno: "other favors" 
[4:54:14] predictions subscriber snosa: damn 
[4:54:58] superultracombo-2023 Left_Justified: atpLook zoneBlush
[4:55:15] Takamatsu2: they evolved to crabs 
[4:55:16] predictions subscriber twitch-recap-2023 Piyokopyo: 🦀 
[4:55:19] predictions subscriber JoGoBeans: crab OYOTrip
[4:55:19] premium hooligan_julian: well 
[4:55:21] premium hooligan_julian: not wrong???? 
[4:55:22] vip afiddler: Stare
[4:55:23] vip SCP096: 🦀 
[4:55:26] predictions subscriber twitch-recap-2023 Piyokopyo: greats8Daxmug
[4:55:26] predictions subscriber snosa: 🦀 🦀 🦀 🦀 
[4:55:27] SovietWinter: monkaS
[4:55:29] twitch-recap-2023 Annonn140: RAGEY
[4:55:29] budderdog_: crab carlPog
[4:55:30] vip bits Jane_Inferno: OTrip
[4:55:34] predictions subscriber snosa: that's sick 
[4:55:35] DumboAKAwumbo: tiny enemy crab carlPog
[4:55:35] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Daxmug
[4:55:36] predictions subscriber partner Temiree: greats8Daxmug
[4:55:39] budderdog_: :)
[4:55:39] Kestrel707: atpJuntao
[4:55:51] predictions subscriber twitch-recap-2023 Piyokopyo: begone crab 
[4:55:59] budderdog_: crab banished 
[4:56:01] superultracombo-2023 Left_Justified: atpCrab
[4:56:03] vip premium lmaoboat: 🦀<-- full of dole 
[4:56:13] subscriber robotsnake: CaraPACE 
[4:56:17] vip premium plorf: carlPog
[4:56:27] SovietWinter: How it happened, is the crab secret 
[4:56:28] vip premium lmaoboat: The answer is shinto is the one true religion 
[4:56:34] sub-gifter NastyRedX: 🦀🗡️ 
[4:57:01] budderdog_: crabface 
[4:57:03] predictions subscriber partner Temiree: I'm not a crab 
[4:57:07] whisperstatic: yuuumans 
[4:57:14] predictions subscriber twitch-recap-2023 Piyokopyo: me? greats8OTrip
[4:57:22] predictions subscriber snosa: carlPog you 
[4:57:29] glitchcon2020 mprQQ: gongo 🦀 is gongone 
[4:57:35] broadcaster turbo GreatSphynx: odoKEK this face even 
[4:57:51] SovietWinter: the crabs want to look like Ice T 
[4:58:15] away0404: i wanna eat the facecrab now 
[4:58:25] predictions subscriber snosa: moo 
[4:58:32] predictions bits nyeaszel: moo 
[4:58:37] whisperstatic: @away0404 BAD LUCK TO KILL A SEABIRD 
[4:58:47] broadcaster turbo GreatSphynx: pretty sure god just snapped his fingers and they were there 
[4:58:52] SovietWinter: Cows come from the cow hills 
[4:59:00] predictions subscriber snosa: they're so cute 
[4:59:03] Takamatsu2: evolve into cow girls or die 
[4:59:19] predictions subscriber JoGoBeans: @GreatSphynx wtf mods is that true? 
[4:59:29] broadcaster turbo GreatSphynx: GerbShock
[4:59:30] predictions bits nyeaszel: monkaS
[4:59:50] SovietWinter: God loves crabs with faces 
[4:59:54] subscriber twitch-recap-2023 ocarina_boy: God just spat some fire bars and shit just happened. Shit's wack greats8ZooTrip
[5:00:04] sub-gifter NastyRedX: they all came from a big boat 4Head
[5:00:14] away0404: CORN <- it made this 
[5:00:20] predictions subscriber snosa: OTrip
[5:00:20] subscriber twitch-recap-2023 ocarina_boy: greats8YoTrip
[5:00:24] predictions subscriber twitch-recap-2023 Piyokopyo: these lil fellas 
[5:00:25] broadcaster turbo GreatSphynx: i ate them all 
[5:00:26] budderdog_: that thang 
[5:00:31] predictions subscriber twitch-recap-2023 Piyokopyo: spyhnx why NOOOO
[5:00:32] predictions subscriber snosa: sphynx wtf 
[5:00:33] SovietWinter: They were not chosen by god 
[5:00:34] subscriber dumbmoths: how could you do this 
[5:00:34] DumboAKAwumbo: PraiseIt
[5:00:37] subscriber twitch-recap-2023 ocarina_boy: the dome fossil sweatFrogM
[5:00:39] glitchcon2020 mprQQ: NOOOO
[5:00:40] moderator founder turbo Dragoneye77: based 
[5:00:44] subscriber twitch-recap-2023 plumblossomrobot: veryCat
[5:00:44] Takamatsu2: thats fucked up 
[5:00:51] budderdog_: chewLes
[5:01:01] sub-gifter NastyRedX: gondaL <-he survived 
[5:01:08] superultracombo-2023 Left_Justified: helix fossil 
[5:01:42] SovietWinter: We'll kill them like we killed all our closely related human cousins goblinPls
[5:01:45] superultracombo-2023 Left_Justified: PraiseIt
[5:01:51] subscriber twitch-recap-2023 ocarina_boy: wideVIBE
[5:01:57] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8ZooTrip
[5:02:06] predictions subscriber snosa: wideVIBE
[5:03:00] broadcaster turbo GreatSphynx: https://cdn.discordapp.com/attachments/1067617858328215562/1189179817199939654/20231226_041407.jpg 
[5:03:11] twitch-recap-2023 WolfzenSkiigh: Towel Cat 
[5:03:13] DumboAKAwumbo: osmoPat
[5:03:16] predictions subscriber snosa: towel cat 
[5:03:16] predictions vip twitch-recap-2023 squirrelcabinet: osmoStare
[5:03:23] FluffaWonderfluff: Osmoooo 
[5:03:25] predictions subscriber snosa: so cute 
[5:03:27] twitch-recap-2023 WolfzenSkiigh: HIS towel 
[5:03:30] Lyvash: OYOTrip
[5:03:38] predictions subscriber twitch-recap-2023 Piyokopyo: osmoBlep mine 
[5:03:39] broadcaster turbo GreatSphynx: catJAMGF catJAMGF catJAMGF
[5:03:40] cheapsushidragon: Purple 
[5:03:44] broadcaster turbo GreatSphynx: osmo has the sticky mutation 
[5:04:10] SovietWinter: Ape together strong 
[5:04:19] subscriber twitch-recap-2023 ocarina_boy: sticky power is op 
[5:05:06] SovietWinter: Damn 1% Hydrogen molecules 
[5:05:06] vip premium lmaoboat: Banger incoming 
[5:05:10] predictions subscriber twitch-recap-2023 Piyokopyo: odoSoup
[5:05:11] predictions subscriber snosa: OTrip
[5:05:11] vip afiddler: ratJAM
[5:05:14] twitch-recap-2023 Fireborn: AlienDance
[5:05:24] twitch-recap-2023 WolfzenSkiigh: Kreygasm Soup 
[5:05:26] Takamatsu2: we are just cosmic rock soup 
[5:05:31] broadcaster turbo GreatSphynx: catJAMGF catJAMGF catJAMGF
[5:05:47] superultracombo-2023 Left_Justified: Tasty
[5:05:59] SovietWinter: Nope, God made all the specific animals 2000 years ago D:
[5:06:23] broadcaster turbo GreatSphynx: veryCat
[5:06:36] broadcaster turbo GreatSphynx: catJAM this song is so good 
[5:06:43] DaWhatTheFox: wideVIBE
[5:06:47] predictions subscriber snosa: wideVIBE
[5:06:49] twitch-recap-2023 joltick2: tell osmo im love himb 
[5:07:13] vip premium plorf: zzooTrip
[5:07:14] broadcaster turbo GreatSphynx: ok 
[5:07:17] vip premium plorf: odoSoup
[5:07:17] DaWhatTheFox: mm soup 
[5:07:23] predictions subscriber JoGoBeans: wideVIBE
[5:07:28] budderdog_: catSittingPolitely
[5:07:35] vip premium lmaoboat: I really love the momentum this song builds up 
[5:07:36] broadcaster turbo GreatSphynx: odoAWOOGA
[5:07:36] predictions bits nyeaszel: SEX 
[5:07:38] moderator founder turbo Dragoneye77: BERMAN
[5:07:38] twitch-recap-2023 Fireborn: BERMUS
[5:07:38] predictions subscriber twitch-recap-2023 Piyokopyo: greats8Bermus
[5:07:38] vip premium lmaoboat: odoAWOOGA
[5:07:39] predictions subscriber JoGoBeans: sex OYOTrip
[5:07:39] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Bermus
[5:07:39] vip bits Jane_Inferno: greats8Bermus
[5:07:40] vip afiddler: wideVIBE
[5:07:40] predictions thedoodler303: BERMUS
[5:07:40] predictions subscriber partner Temiree: greats8Roiker
[5:07:41] predictions subscriber snosa: BERMAN
[5:07:42] SovietWinter: ptypeSumg
[5:07:42] predictions bits nyeaszel: BERMUS
[5:07:43] twitch-recap-2023 joltick2: sexo? 
[5:07:43] vip SCP096: odoAWOOGA
[5:07:43] superultracombo-2023 Left_Justified: zoneSmug
[5:07:44] predictions deworming_in_progress: odoAWOOGA novemnber 
[5:07:58] broadcaster turbo GreatSphynx: catBoom
[5:08:03] predictions subscriber snosa: Explosion
[5:08:07] vip premium plorf: greats8OTrip
[5:08:08] predictions thedoodler303: catBoom
[5:08:19] SovietWinter: All the bacteria that made the ozone is top5 
[5:08:25] moderator partner DesertP: how does he know this 
[5:08:27] moderator partner DesertP: was he there 
[5:08:32] vip premium plorf: yeah 
[5:08:33] predictions subscriber snosa: yes 
[5:08:40] SovietWinter: He's there right now 
[5:08:41] Takamatsu2: isnt he there right now 
[5:08:49] moderator partner DesertP: woahj 
[5:08:53] twitch-recap-2023 joltick2: hes a timelord 
[5:09:05] broadcaster turbo GreatSphynx: squid era 
[5:09:11] vip premium plorf: scrondle 
[5:09:19] moderator partner DesertP: squid time 
[5:09:23] predictions bits nyeaszel: BWRMAN 
[5:09:24] predictions bits nyeaszel: BERMAN
[5:09:33] SovietWinter: Get extincted idiots D:
[5:09:40] premium ArrowgentLogician: BeanieHipster
[5:09:41] predictions subscriber snosa: zzooTrip
[5:09:46] premium ArrowgentLogician: CarlSmile
[5:09:48] twitch-recap-2023 Karmalsauce: PEPPERONI
[5:10:01] vip afiddler: PogChamp
[5:10:05] vip premium plorf: OYOTrip
[5:10:05] predictions subscriber partner Temiree: Especially Desert 
[5:10:06] nonwovenfabric: lol 
[5:10:06] predictions subscriber twitch-recap-2023 Piyokopyo: greats8YoTrip that was 2 days ago 
[5:10:06] predictions subscriber snosa: PogChamp
[5:10:06] broadcaster turbo GreatSphynx: merry christmas dinosuars 
[5:10:07] SovietWinter: look at that goofy boy 
[5:10:11] superultracombo-2023 Left_Justified: @SovietWinter respect your elders ratJAM
[5:10:13] predictions thedoodler303: DinoDance
[5:10:15] predictions subscriber snosa: best christmas present ever 
[5:10:17] twitch-recap-2023 joltick2: a fish breathed air and because of that i have to work the rest of my life. 
[5:10:19] Takamatsu2: they already celebrated jesus back then 
[5:10:20] moderator founder turbo Dragoneye77: desert was there 
[5:10:26] predictions subscriber JoGoBeans: pogonaChamp
[5:10:36] predictions subscriber twitch-recap-2023 Piyokopyo: TODAY 
[5:10:37] predictions deworming_in_progress: jmikeRatgirl
[5:10:39] predictions subscriber snosa: OYOTrip
[5:10:41] predictions bits nyeaszel: carlPog
[5:10:43] subscriber robotsnake: wow 
[5:10:43] SovietWinter: @Left_Justified mammals 4lyfe 
[5:10:50] predictions subscriber twitch-recap-2023 Piyokopyo: greats8OdoNo
[5:10:52] superultracombo-2023 Venneh: Oh no 
[5:10:52] predictions subscriber snosa: NOOOO
[5:10:54] predictions thedoodler303: NOOOO
[5:10:55] moderator founder turbo Dragoneye77: sorry i did it 
[5:10:56] predictions bits nyeaszel: odoNo
[5:10:59] superultracombo-2023 Left_Justified: i ate them :)
[5:11:01] Takamatsu2: ligma docDis
[5:11:02] twitchcon2017 RossTB: planet was dominated by giant chickens 
[5:11:03] predictions subscriber twitch-recap-2023 Piyokopyo: you fuck you ate them all 
[5:11:03] predictions bits nyeaszel: deadass
[5:11:06] twitch-recap-2023 WolfzenSkiigh: Too soon 
[5:11:08] predictions deworming_in_progress: the cause is unknown? 
[5:11:09] predictions subscriber snosa: gfdi 
[5:11:11] predictions subscriber twitch-recap-2023 Piyokopyo: there's no stopping either of you 
[5:11:13] subscriber robotsnake: atpFeelsBeardMan Dinosaurs gone forever.... 
[5:11:14] broadcaster turbo GreatSphynx: sphynxBrain
[5:11:15] subscriber twitch-recap-2023 ocarina_boy: the first creechers 
[5:11:17] SovietWinter: even if warning, not sure what the Dinosaurs would have done about it. 
[5:11:42] SovietWinter: Yea but we have PS2 
[5:11:52] predictions bits nyeaszel: SOUP 
[5:11:54] twitch-recap-2023 joltick2: soup 
[5:11:56] predictions subscriber snosa: odoSoup
[5:11:59] predictions subscriber twitch-recap-2023 Piyokopyo: catJammingPolitely ViolinTime
[5:11:59] vip afiddler: ratJAM
[5:12:00] predictions vip twitch-recap-2023 squirrelcabinet: Tasty
[5:12:11] twitch-recap-2023 Karmalsauce: Plinktosis
[5:12:16] predictions bits nyeaszel: Plinktosis
[5:12:23] predictions deworming_in_progress: Plinktosis ffzX Plinktosis
[5:12:25] vip premium plorf: Plinktosis
[5:12:34] predictions subscriber snosa: Plinktosis
[5:12:41] predictions subscriber snosa: now we have gongo
[5:13:06] predictions subscriber partner Temiree: Plinktosis
[5:13:08] predictions bits nyeaszel: mmmm stomodeum 
[5:13:13] SovietWinter: Grampa Pollip 
[5:13:17] superultracombo-2023 Venneh: Cousin pog 
[5:13:19] predictions subscriber partner Temiree: speak for yourself 
[5:13:24] predictions subscriber snosa: OYOTrip
[5:13:27] subscriber twitch-recap-2023 ocarina_boy: 🪱 
[5:13:34] vip premium plorf: gondaL
[5:13:49] twitchcon2017 RossTB: I didn't come from no monkey KKona
[5:13:51] predictions subscriber JoGoBeans: jmikeNoted
[5:13:57] predictions deworming_in_progress: jmikeLetsgluck VERTEBRAE 
[5:14:02] vip premium plorf: odoKEK
[5:14:03] subscriber twitch-recap-2023 ocarina_boy: GrillTime
[5:14:14] predictions deworming_in_progress: then the fish developed FISHWAR
[5:14:20] superultracombo-2023 Venneh: That's me 
[5:14:21] twitch-recap-2023 WolfzenSkiigh: Yeah when I evolved eyes it was wild 
[5:14:24] budderdog_: GrillTime
[5:14:24] SovietWinter: They should have spec'd into thumbs 
[5:14:24] predictions subscriber twitch-recap-2023 n0tthedoctor: FISHWAR
[5:14:29] sub-gifter NastyRedX: catJAMGF
[5:14:32] predictions subscriber snosa: GrillTime
[5:14:33] twitch-recap-2023 Fireborn: GrillTime
[5:14:52] SovietWinter: how does one evolve a lunge 
[5:14:52] subscriber twitch-recap-2023 ocarina_boy: greats8JAM ViolinTime
[5:14:53] predictions subscriber snosa: leg time 
[5:14:55] predictions bits nyeaszel: zzooTrip
[5:15:00] GUY_KAZAMA: The
[5:15:01] subscriber twitch-recap-2023 ocarina_boy: greats8Froggy
[5:15:07] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Froggy
[5:15:08] budderdog_: froggyFace
[5:15:09] vip DarkFlame7755: @SovietWinter you unlock that skill at level 12 for most classes 
[5:15:13] SovietWinter: water in the egg. baby in the water in the egg 
[5:15:16] Tiphias: and when we discover Transwarp, we will return to those days 
[5:15:21] budderdog_: DinoDance
[5:15:23] premium FoxTenson: The
[5:15:31] vip premium plorf: PEPPERONI
[5:15:36] superultracombo-2023 Left_Justified: go birds atpBird
[5:15:36] sub-gifter NastyRedX: need to evolve more lungs so i can vape more 
[5:15:47] subscriber robotsnake: "dinosirs" 
[5:15:50] predictions subscriber twitch-recap-2023 Piyokopyo: spanX
[5:15:58] SovietWinter: rats 
[5:16:00] subscriber twitch-recap-2023 ocarina_boy: ratJAM
[5:16:00] Kestrel707: Dinosewers 
[5:16:02] vip afiddler: ratJAM
[5:16:05] DaWhatTheFox: catJammingPolitely
[5:16:07] twitch-recap-2023 Fireborn: ratJAM
[5:16:19] subscriber twitch-recap-2023 ocarina_boy: jmikeRatgirl
[5:16:21] DaWhatTheFox: brain growing too big 
[5:16:23] moderator partner DesertP: bober kurwa 
[5:16:32] twitch-recap-2023 WolfzenSkiigh: love this song 
[5:16:33] SovietWinter: THAT'S ME 
[5:16:44] subscriber twitch-recap-2023 ocarina_boy: 🦧 
[5:16:50] DaWhatTheFox: baby baboon catJammingPolitely
[5:16:54] sub-gifter NastyRedX: odoSoyR
[5:17:17] SovietWinter: Can you imagine not evolving into a human 
[5:17:18] moderator partner DesertP: we learned what depression is 
[5:17:23] SovietWinter: And just being a regular monkey 
[5:17:24] vip premium plorf: odoAnguish
[5:17:28] DaWhatTheFox: wtf put it back in your head 
[5:17:30] Takamatsu2: we should be about evolve again 
[5:17:35] moderator partner DesertP: BERMAN
[5:17:37] superultracombo-2023 Left_Justified: @SovietWinter I want my tail back atpFeelsBeardMan
[5:17:38] twitch-recap-2023 Karmalsauce: catPls
[5:17:42] predictions subscriber snosa: catPls
[5:17:43] predictions bits nyeaszel: Plinktosis
[5:17:45] predictions subscriber twitch-recap-2023 Piyokopyo: catJAM
[5:17:45] predictions subscriber partner Temiree: catPls
[5:17:48] sub-gifter NastyRedX: we created sandwiches OYOTrip
[5:17:49] DaWhatTheFox: catJAM
[5:17:53] SovietWinter: A tail would be pretty dope 
[5:17:54] twitch-recap-2023 WolfzenSkiigh: @Left_Justified no refunds 
[5:18:00] vip premium lmaoboat: @DesertP Ape together sad greats8OdoNo
[5:18:00] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM
[5:18:04] superultracombo-2023 pjgrich: I too want my tail back 
[5:18:15] sub-gifter NastyRedX: would do all that for a ham and cheese OYOTrip
[5:18:16] superultracombo-2023 Left_Justified: Wawa
[5:18:20] subscriber twitch-recap-2023 ocarina_boy: Clap
[5:18:21] twitch-recap-2023 WolfzenSkiigh: Speedrunning evolution 
[5:18:25] predictions subscriber partner Temiree: greatSprig
[5:18:32] broadcaster turbo GreatSphynx: osmoLick <- peak of evolution 
[5:18:40] moderator partner DesertP: Bleh
[5:18:56] superultracombo-2023 Left_Justified: carlPog Yggdrasil 
[5:18:58] predictions vip GodliestCat64: Bleh
[5:19:04] SovietWinter: Mushrooms are nuts 
[5:19:14] vip premium lmaoboat: Afinitree 
[5:19:17] predictions subscriber snosa: as a human i do love trees 
[5:19:28] superultracombo-2023 Venneh: Tree hype 
[5:19:34] vip premium lmaoboat: @SovietWinter No, they're fungi greats8Bruh
[5:19:36] moderator partner DesertP: i love to destroy trees i love seeing blonde women with chainsaws deforest the amazon 
[5:19:47] broadcaster turbo GreatSphynx: odoAWOOGA FIRE
[5:19:59] vip premium lmaoboat: @DesertP chewLes Mmm, wonderbread 
[5:20:11] sub-gifter NastyRedX: greatSprig FluteTime
[5:20:12] vip premium Monopool: build more parking lots 
[5:20:20] predictions subscriber snosa: q 
[5:20:37] moderator partner DesertP: HA 
[5:20:38] broadcaster turbo GreatSphynx: veryCat ty plant 
[5:20:40] SovietWinter: yoink 
[5:20:40] vip premium lmaoboat: Planty business 
[5:20:52] predictions subscriber JoGoBeans: chat steals from plants? D:
[5:20:54] vip premium Monopool: veryCat
[5:20:55] predictions subscriber snosa: chewLes
[5:21:00] predictions bits nyeaszel: chewLes
[5:21:11] moderator partner DesertP: you ever think about how some plants want you to eat them and shit them out like they actually want that they want to be in your ass 
[5:21:12] predictions vip GodliestCat64: Crunch
[5:21:21] BeamingButt: But plants dont have boobs 
[5:21:22] twitch-recap-2023 Fireborn: Tasty
[5:21:26] predictions deworming_in_progress: @DesertP no i dont 
[5:21:38] moderator partner DesertP: you should 
[5:21:40] moderator partner DesertP: its good fiber 
[5:21:43] Takamatsu2: now i do 
[5:21:45] predictions subscriber JoGoBeans: then peppers are like nooo don't eat us we hurt your mouth and we eat them anyway zzooTrip
[5:21:50] superultracombo-2023 Left_Justified: @BeamingButt some trees have butts. 
[5:21:51] predictions bits nyeaszel: one cock 
[5:21:52] vip premium Monopool: gongo <- 5 letters 
[5:22:31] broadcaster turbo GreatSphynx: CORN
[5:22:38] BeamingButt: @Left_Justified enough for there to be a field in dendroproctology? 
[5:22:43] twitch-recap-2023 Karmalsauce: catPls FluteTime
[5:22:43] SovietWinter: Gold, Platinum, Zinc, Titanium 
[5:23:05] broadcaster turbo GreatSphynx: catSnail
[5:23:48] broadcaster turbo GreatSphynx: NOOOO
[5:23:50] subscriber Hexagon_2: SillyCat
[5:23:53] SovietWinter: D:
[5:23:54] twitch-recap-2023 Karmalsauce: monkaS
[5:23:54] superultracombo-2023 Venneh: Psycho 
[5:23:55] Rooks_Castle: D:
[5:23:58] BeamingButt: the magic school bus
[5:23:59] predictions bits nyeaszel: zzooTrip
[5:24:02] predictions subscriber partner Temiree: D:
[5:24:04] predictions vip GodliestCat64: D:
[5:24:05] superultracombo-2023 Left_Justified: @BeamingButt Arboreal Proctology TPFufun
[5:24:06] Garfsune_Miku: GORE 
[5:24:26] superultracombo-2023 pjgrich: Is this REAL? 
[5:24:26] SovietWinter: This is some 60's Scifi ass music 
[5:24:39] BeamingButt: @Left_Justified i want to butt the very best, like no one ever was 
[5:24:49] superultracombo-2023 pjgrich: How the hell did anyone figure THIS out? 
[5:24:56] vip SCP096: they made it up 
[5:24:59] broadcaster turbo GreatSphynx: science 
[5:25:01] predictions deworming_in_progress: they looked really close 
[5:25:02] superultracombo-2023 pjgrich: ah of course 
[5:25:03] predictions subscriber partner Temiree: looks like Subnautica 
[5:25:06] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8Roiker
[5:25:14] broadcaster turbo GreatSphynx: we have like computer generated images of scans that like animate and show how some of these messenger things work 
[5:25:17] BeamingButt: dont mind my incoherent ramblings. Havent slept in 2 days. 
[5:25:17] SovietWinter: They asked chatgpt 
[5:25:18] broadcaster turbo GreatSphynx: and they are funny af looking 
[5:25:32] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8ZooTrip
[5:25:36] predictions subscriber partner Temiree: @GreatSphynx Oh yeah I've seen a few of those LUL
[5:25:37] predictions bits nyeaszel: zzooTrip 󠀀 
[5:25:44] SovietWinter: I have acid in my blood?! D:
[5:25:45] broadcaster turbo GreatSphynx: https://giphy.com/gifs/protein-kinesin-Vg711CGH7x55K 
[5:26:00] subscriber twitch-recap-2023 ocarina_boy: lmao that was the exact one I was thinking of 
[5:26:01] predictions deworming_in_progress: @GreatSphynx YES the little walking fellas 
[5:26:10] subscriber Hexagon_2: mapiesHeh
[5:26:14] predictions subscriber partner Temiree: @GreatSphynx just having a good time 
[5:26:18] broadcaster turbo GreatSphynx: your body is just full of little wiggly strings of protein and stuff 
[5:26:19] predictions bits nyeaszel: look at that dude struttin his ass 
[5:26:23] subscriber twitch-recap-2023 ocarina_boy: little guy's got swagger 
[5:26:30] superultracombo-2023 Left_Justified: evo18MindBlown stellar DNA 
[5:26:40] broadcaster turbo GreatSphynx: that little fella is responsible for your depression dataBruh
[5:26:48] subscriber twitch-recap-2023 ocarina_boy: greats8OdoNo
[5:26:48] glitchcon2020 mprQQ: NOOOO 󠀀 
[5:26:50] predictions deworming_in_progress: "do it for him" poster but it's my walking protein guy 
[5:26:55] predictions vip GodliestCat64: greats8Daxmug godGrabbingYouR Rip that fella out 
[5:26:57] SovietWinter: Yea, its all weird little tools 
[5:27:03] vip afiddler: ratJAM
[5:27:05] predictions subscriber snosa: siskoPulp
[5:27:05] predictions bits nyeaszel: chat 
[5:27:11] superultracombo-2023 Venneh: Soup 
[5:27:13] twitch-recap-2023 zennichu: chatPls
[5:27:15] superultracombo-2023 pjgrich: @GreatSphynx That is not true!!!! 
[5:27:18] Takamatsu2: thank god this is automatic i would mess it up 
[5:27:20] Rooks_Castle: My insides are Me Soup 
[5:27:34] superultracombo-2023 pjgrich: How the hell does Life? 
[5:27:35] SovietWinter: @Takamatsu2 LUL
[5:27:39] predictions bits nyeaszel: yumans hurting each other for survival just for the tiny little guys to s u r v i v e 
[5:27:40] predictions subscriber JoGoBeans: catPls
[5:27:57] superultracombo-2023 pjgrich: y'know what I don't care as long as it works yeah? 
[5:27:59] broadcaster turbo GreatSphynx: https://tenor.com/view/kinesin-walking-protein-microtubule-hydrolysis-gif-18575672 
[5:28:06] predictions bits nyeaszel: fair enuf 
[5:28:09] broadcaster turbo GreatSphynx: wait that was thw wong one 
[5:28:09] predictions subscriber JoGoBeans: swiggity swooty 
[5:28:10] broadcaster turbo GreatSphynx: wrong 
[5:28:13] predictions subscriber snosa: when u walking 
[5:28:13] superultracombo-2023 Venneh: Like wolverine 
[5:28:13] twitch-recap-2023 Fireborn: zzooTrip
[5:28:17] broadcaster turbo GreatSphynx: https://tenor.com/view/paimon-gif-25596805 
[5:28:19] superultracombo-2023 pjgrich: why is it so cute omg :3 :(
[5:28:28] Takamatsu2: HungryPaimon
[5:28:29] broadcaster turbo GreatSphynx: idk why all the related gifs are anime girls 
[5:28:31] predictions subscriber twitch-recap-2023 Piyokopyo: paimon-gif 
[5:28:32] predictions deworming_in_progress: why is it paimon 
[5:28:32] predictions subscriber snosa: lol very real 
[5:28:33] predictions bits nyeaszel: monkaS
[5:28:35] subscriber twitch-recap-2023 ocarina_boy: why is that gif called paimon lmao HungryPaimon
[5:28:40] SovietWinter: So this little shit is responsible for color blindness and Huntingon's D:
[5:28:41] vip premium Monopool: zzooTrip what if there were like little guys living inside one of your cells and your body was their galaxy, and ours was the same way 
[5:28:43] broadcaster turbo GreatSphynx: wideHUH
[5:28:43] superultracombo-2023 pjgrich: it's just the protein throwing ass 
[5:28:52] RohanFalcon: jmikeMald Blend that Paimon! 
[5:28:53] predictions subscriber snosa: remain blissfully unaware sphyx 
[5:28:53] vip premium plorf: genshin microtubules 
[5:28:57] broadcaster turbo GreatSphynx: maybe you have little anime girls in you and thats why you are depressed 
[5:29:02] subscriber twitch-recap-2023 ocarina_boy: makes sense 
[5:29:04] predictions subscriber twitch-recap-2023 Piyokopyo: that explains a lot 
[5:29:04] predictions bits nyeaszel: odoNo
[5:29:06] predictions subscriber snosa: yeah 
[5:29:07] predictions vip GodliestCat64: @Monopool isnt that an eddie murphy movie 
[5:29:09] halmisae_: odoNo
[5:29:13] superultracombo-2023 pjgrich: I don't I have furries but they make the depression better 
[5:29:17] SovietWinter: cells at work is a pretty good anime 
[5:29:35] vip premium Monopool: osmosis jones 
[5:30:00] predictions subscriber partner Temiree: @pjgrich temireClap
[5:30:13] broadcaster turbo GreatSphynx: catJAMGF catJAMGF catJAMGF catJAMGF
[5:30:14] predictions subscriber twitch-recap-2023 Piyokopyo: wideVIBE
[5:30:21] SovietWinter: We are legion 
[5:30:21] predictions subscriber partner Temiree: catJammingPolitely
[5:30:21] broadcaster turbo GreatSphynx: bring us back vivaldi 
[5:30:22] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8ZooTrip
[5:30:22] predictions subscriber JoGoBeans: wideVIBE
[5:30:22] DaWhatTheFox: wideVIBE wideVIBE
[5:30:25] predictions subscriber snosa: wideVIBE
[5:30:27] predictions deworming_in_progress: thank you, m'cells 
[5:30:27] superultracombo-2023 Venneh: Pog 
[5:30:27] vip premium Monopool: zzooTrip
[5:30:29] predictions bits nyeaszel: wideVIBE
[5:30:35] predictions vip GodliestCat64: wideVIBE
[5:30:35] DaWhatTheFox: yummy 
[5:30:36] superultracombo-2023 Venneh: Vampire 
[5:30:38] predictions bits nyeaszel: mmmm ketchup 
[5:30:39] predictions subscriber partner Temiree: tasty 
[5:30:46] SovietWinter: my cells want me to stop drinking. But they're not the boss of me! 
[5:30:59] predictions bits nyeaszel: technically saliva has enzymes that help stop bleeding 
[5:31:00] broadcaster turbo GreatSphynx: https://sciencegifs.csullender.com/assets/img/2017-03-25-Motor-protein-traversing-a-microtubule.gif 
[5:31:04] broadcaster turbo GreatSphynx: o i found another one 
[5:31:12] broadcaster turbo GreatSphynx: that looks like a dangerous job 
[5:31:19] vip premium fealiksg: he walkin 
[5:31:24] superultracombo-2023 pjgrich: that site is BROKE 
[5:31:34] predictions bits nyeaszel: site no work odoNo
[5:31:35] SovietWinter: I am a human being #56216553 
[5:31:39] predictions subscriber partner Temiree: @GreatSphynx oh no what if he falls oh fuck 
[5:31:40] broadcaster turbo GreatSphynx: really? 
[5:31:46] broadcaster turbo GreatSphynx: https://sciencegifs.csullender.com/2017/03/25/Motor-protein-traversing-a-microtubule.html 
[5:31:47] predictions subscriber JoGoBeans: works for me :)
[5:31:47] broadcaster turbo GreatSphynx: ? 
[5:31:49] predictions subscriber twitch-recap-2023 Piyokopyo: it loads for me 
[5:31:55] superultracombo-2023 Venneh: It works 
[5:31:57] predictions bits nyeaszel: it now loads 
[5:32:03] predictions subscriber snosa: sisyphus 
[5:32:05] Lurilurilu: gongoCrystal gongoCrystal gongoCrystal
[5:32:07] vip SCP096: i was a motor protein in a past life 
[5:32:12] SovietWinter: I want my human being to be a lizard 
[5:32:15] broadcaster turbo GreatSphynx: i like that there are weird worms on the tubes next to him 
[5:32:20] broadcaster turbo GreatSphynx: there should be a game like this 
[5:32:23] vip premium fealiksg: yuman beengs 
[5:32:23] subscriber dumbmoths: weee 
[5:32:24] broadcaster turbo GreatSphynx: where you are a little wiggly fella 
[5:32:26] broadcaster turbo GreatSphynx: wiggly souls 
[5:32:27] predictions deworming_in_progress: death stranding 
[5:32:28] vip premium Monopool: who up motoring their protein? 
[5:32:39] subscriber dumbmoths: i need wiggly souls 
[5:32:55] broadcaster turbo GreatSphynx: SPRIGGLE
[5:32:56] subscriber twitch-recap-2023 ocarina_boy: wiggly soles 
[5:33:04] predictions subscriber snosa: SPRIGGLE
[5:33:05] predictions bits nyeaszel: crispr moment 
[5:33:05] SovietWinter: monkaS
[5:33:08] predictions bits nyeaszel: SPRIGGLE
[5:33:14] subscriber dumbmoths: trees are reading you right now chat 
[5:33:20] predictions vip GodliestCat64: Woag... zzooTrip
[5:33:21] subscriber twitch-recap-2023 ocarina_boy: any trees in chat 
[5:33:23] predictions vip GodliestCat64: Hello from trees 
[5:33:25] predictions subscriber snosa: daxMug
[5:33:26] twitch-recap-2023 Karmalsauce: wiseTree 
[5:33:28] vip premium lmaoboat: Tree stuff 
[5:33:32] broadcaster turbo GreatSphynx: i have a slime gf in lunacid 
[5:33:39] subscriber twitch-recap-2023 ocarina_boy: poggers 
[5:33:53] cheapsushidragon: Treesistance 
[5:33:55] subscriber dumbmoths: shout out jellisha 
[5:33:59] SovietWinter: they came here on a rock D:
[5:34:01] vip artist-badge Raxxmus: wtf Jellisha said she was MY girlfriend??? 
[5:34:04] vip artist-badge Raxxmus: the cheater 
[5:34:07] broadcaster turbo GreatSphynx: Uhhh
[5:34:08] subscriber twitch-recap-2023 ocarina_boy: catJAM
[5:34:20] sub-gifter NastyRedX: HUHH
[5:34:22] twitch-recap-2023 Karmalsauce: osmoStare
[5:34:23] vip premium Monopool: the stuff 
[5:34:28] predictions subscriber snosa: zzooTrip
[5:34:29] twitch-recap-2023 WolfzenSkiigh: The Stuff(tm) 
[5:34:35] broadcaster turbo GreatSphynx: oh ty mrfecalsauce66 i missed ur sub earlier 
[5:34:42] subscriber dumbmoths: jellisha just called me cute didn't even give me chance for romance 
[5:34:43] broadcaster turbo GreatSphynx: oh i guess you arent here anymore 
[5:34:48] broadcaster turbo GreatSphynx: dataBruh
[5:34:48] subscriber dumbmoths: shoutout mrfecalsauce 
[5:34:52] predictions vip GodliestCat64: lmao 
[5:34:54] SovietWinter: monkaS this guys 
[5:35:05] broadcaster turbo GreatSphynx: this scientist is making the fecal sauce rn 
[5:35:18] subscriber twitch-recap-2023 ocarina_boy: it's a very difficult process 
[5:35:28] subscriber dumbmoths: godspeed fecal scientist 
[5:35:38] predictions deworming_in_progress: monkaS wtf we're running out of hydrogen 
[5:35:55] predictions subscriber snosa: Uhhh
[5:35:57] predictions deworming_in_progress: Uhhh
[5:35:59] twitch-recap-2023 Karmalsauce: Uhhh
[5:36:00] predictions subscriber twitch-recap-2023 Piyokopyo: lesPain
[5:36:03] predictions bits nyeaszel: odoSoup
[5:36:21] vip SCP096: drogas 
[5:36:24] vip premium fealiksg: loving the drama here 
[5:36:35] moderator partner DesertP: the worlds most complicated vaporizor 
[5:36:37] moderator founder turbo Dragoneye77: chat 
[5:36:39] moderator founder turbo Dragoneye77: bed is comfy 
[5:36:49] broadcaster turbo GreatSphynx: Cat420
[5:36:52] FluffaWonderfluff: Jesse we need to cook, we're replicating the origin of life Jesse 
[5:36:56] predictions bits nyeaszel: zzooTrip
[5:37:02] SovietWinter: ew 
[5:37:04] vip premium fealiksg: they made slop 
[5:37:06] predictions subscriber JoGoBeans: blood 
[5:37:08] subscriber twitch-recap-2023 ocarina_boy: fecal 
[5:37:08] twitch-recap-2023 Karmalsauce: monkaS SCORN 
[5:37:10] predictions subscriber partner Temiree: @Dragoneye77 prawnzCozy
[5:37:10] broadcaster turbo GreatSphynx: the filth 
[5:37:13] vip SCP096: dataSmoke
[5:37:13] predictions bits nyeaszel: zzooTrip LCL 
[5:37:14] predictions deworming_in_progress: monkaS LCL fluid 
[5:37:14] predictions subscriber twitch-recap-2023 Piyokopyo: dataPong BongTime
[5:37:15] vip Snudl: CokeShakey
[5:37:21] twitch-recap-2023 WolfzenSkiigh: Taco Bell simulator 
[5:37:23] broadcaster turbo GreatSphynx: picMin
[5:37:50] eggd0g: veryCat primordial ooze 
[5:38:34] predictions bits nyeaszel: this first step to making catgirls 
[5:38:40] broadcaster turbo GreatSphynx: GREAT GLOBS 
[5:38:41] predictions subscriber partner Temiree: I'm gonna eat the ooze 
[5:38:46] vip premium plorf: globgo 
[5:38:58] predictions subscriber JoGoBeans: soundtrack sounds like it's about the drop the sickest beat 
[5:38:58] moderator Vidyabum: 68 raiders from Vidyabum have joined! 
[5:38:59] SovietWinter: He's making Ivan Ooze monkaS
[5:39:00] predictions subscriber snosa: GLOBS of this stuff 
[5:39:02] predictions subscriber snosa: hi
[5:39:02] predictions bits nyeaszel: OYOTrip
[5:39:02] predictions vip GodliestCat64: greats8Daxmug Raid greats8Daxmug
[5:39:08] premium UroWasHere: REND 
[5:39:09] broadcaster turbo GreatSphynx: ty jeff 
[5:39:12] superultracombo-2023 careful_crab: :)
[5:39:15] predictions subscriber partner Temiree: greats8Daxmug
[5:39:24] twitch-recap-2023 Karmalsauce: daxMug
[5:39:30] predictions bits nyeaszel: daxMug
[5:39:57] moderator founder turbo Dragoneye77: huge jeff 
[5:40:14] superultracombo-2023 careful_crab: GIGAJEFF 
[5:40:16] predictions subscriber JoGoBeans: catJAMM
[5:40:26] predictions subscriber snosa: VIBE
[5:40:27] moderator founder turbo Dragoneye77: oh hey sphynx you said you like that astrum guy yea? 
[5:40:35] broadcaster turbo GreatSphynx: some of his videos yeah 
[5:40:38] vip premium Monopool: zzooTrip
[5:40:42] predictions bits nyeaszel: zzooTrip
[5:40:48] Garfsune_Miku: greats8YoTrip
[5:40:49] predictions subscriber partner Temiree: greats8YoTrip
[5:40:54] broadcaster turbo GreatSphynx: catJAMGF catJAMGF catJAMGF
[5:40:54] porig: monkaS
[5:40:57] vip premium fealiksg: whoagh 
[5:40:59] predictions subscriber snosa: CatApple 
[5:41:01] moderator founder turbo Dragoneye77: I was looking at his voyager 1 video and pretty funny/cool he talks about my university 
[5:41:02] subscriber Hexagon_2: greats8Ytrip
[5:41:06] predictions bits nyeaszel: odoSoup
[5:41:10] broadcaster turbo GreatSphynx: yeah the voyager one is good 
[5:41:15] broadcaster turbo GreatSphynx: also the cassini one from a few months ago is good 
[5:41:22] predictions subscriber partner Temiree: these illustrations are sick 
[5:41:27] predictions subscriber snosa: yeah fr 
[5:41:30] moderator founder turbo Dragoneye77: yeah he mentioned johns hopkins is proposing a new deep space probe 
[5:41:42] subscriber robotsnake: Wait is this Wayne Barlowe's art? 
[5:41:44] predictions subscriber JoGoBeans: chat are you a floater or a sinker? 
[5:41:51] predictions subscriber snosa: sinker for sure 
[5:41:53] broadcaster turbo GreatSphynx: im a gongo
[5:41:54] moderator founder turbo Dragoneye77: turn out theres a few science labs of the school down by cape caravel 
[5:41:57] vip premium fealiksg: im a stinker 
[5:41:59] deepspacejani: Floater here 
[5:42:09] predictions bits nyeaszel: stinker here checking in 
[5:42:10] twitch-recap-2023 WolfzenSkiigh: We all float in here 
[5:42:46] moderator founder turbo Dragoneye77: OSMO UPDATE 
[5:42:47] twitch-recap-2023 joltick2: c osmo s 
[5:42:48] predictions vip GodliestCat64: greats8YoTrip
[5:42:50] predictions subscriber snosa: ALERTA
[5:42:52] Garfsune_Miku: R N A 
[5:42:56] porig: NEW UPDATE?? 
[5:43:08] vip premium Monopool: monkaS they patched it 
[5:43:19] deepspacejani: DLC dropped 
[5:43:31] Garfsune_Miku: Nerf R-N-A pls OP 
[5:43:48] predictions subscriber snosa: Explosion
[5:43:49] moderator founder turbo Dragoneye77: oh wait 
[5:43:59] moderator founder turbo Dragoneye77: that was a thing they only found out 40ish years ago? 
[5:44:02] Garfsune_Miku: Furries 
[5:44:04] predictions subscriber partner Temiree: not the furries D:
[5:44:12] broadcaster turbo GreatSphynx: yeah 
[5:44:14] deepspacejani: We all furries 
[5:44:14] moderator founder turbo Dragoneye77: the comet that wiped out the dinosaurs 
[5:44:17] moderator founder turbo Dragoneye77: huh I didnt know that 
[5:44:22] vip premium Monopool: space furries 
[5:44:24] vip premium fealiksg: Clap
[5:44:26] subscriber twitch-recap-2023 ocarina_boy: carlPog
[5:44:28] subscriber twitch-recap-2023 ocarina_boy: Clap
[5:44:30] vip Snudl: Furries have and will inherit the ashes of the world 
[5:44:30] moderator founder turbo Dragoneye77: I thought we knew about it a bit further back 
[5:44:31] predictions subscriber partner Temiree: temireClap
[5:44:33] predictions bits nyeaszel: carlpog Clap
[5:44:33] subscriber Hexagon_2: Clap
[5:44:34] Garfsune_Miku: Clap
[5:44:36] deepspacejani: It all makes sense now 
[5:44:37] predictions vip GodliestCat64: Clap
[5:44:40] predictions subscriber JoGoBeans: wideVIBE
[5:44:43] porig: Guys, are we the space furries? 
[5:44:46] cheapsushidragon: BedgeCat BedgeCat BedgeCat
[5:45:00] glhf-pledge empanadas_in_pinatas: Thank you for the science lesson 
[5:45:01] moderator founder turbo Dragoneye77: arent space furries just those things from signal simulator 
[5:45:03] predictions subscriber snosa: Clap
[5:45:03] SirLurksaIot: gleebyDeeby space furries 
[5:45:03] twitch-recap-2023 WolfzenSkiigh: Clap
[5:45:13] subscriber twitch-recap-2023 plumblossomrobot: GLEEBING
[5:45:15] twitch-recap-2023 WolfzenSkiigh: @pifrogo Yes 
[5:45:18] subscriber twitch-recap-2023 ocarina_boy: @pifrogo 🔫 always were 
[5:45:22] predictions subscriber partner Temiree: Star Fox is a space furry 
[5:45:25] vip Snudl: dumbmo1Peeby
[5:45:36] KingCoughin: does this mean jedi and sith are real? greats8Ytrip
[5:45:37] moderator founder turbo Dragoneye77: Osmo collectors edition 
[5:45:37] Rooks_Castle: Clap
[5:45:42] twitch-recap-2023 WolfzenSkiigh: @KingCoughin also yes 
[5:46:17] broadcaster turbo GreatSphynx: im gonna do one more thing 
[5:46:18] broadcaster turbo GreatSphynx: after break 
[5:46:20] vip premium fealiksg: hell yes 
[5:46:23] predictions subscriber snosa: WHAT
[5:46:23] broadcaster turbo GreatSphynx: nothing special, just some old cgi 
[5:46:24] predictions bits nyeaszel: OYOTrip
[5:46:26] vip premium Monopool: longo 
[5:46:30] vip premium fealiksg: HELL YES 
[5:46:33] broadcaster turbo GreatSphynx: !break 
[5:46:33] moderator partner Nightbot: It's time for a break, don't go away. 3min of ads will play so you don't have to see any ads for the next hour. Otherwise chill and enjoy the music. 
[5:46:35] predictions vip GodliestCat64: Cgi greats8YoTrip
[5:46:36] predictions subscriber snosa: catPls
[5:46:42] subscriber Hexagon_2: greats8Bounce
[5:46:44] predictions subscriber partner Temiree: Oh this feels fun in my ears 
[5:46:46] glhf-pledge empanadas_in_pinatas: Love some janky cgi 
[5:46:46] subscriber twitch-recap-2023 ocarina_boy: greats8ZooTrip
[5:46:48] vip premium Monopool: catPls
[5:46:50] vip premium lmaoboat: Paperstep 
[5:46:53] subscriber twitch-recap-2023 ocarina_boy: jmikeNoted
[5:46:55] vip twitch-recap-2023 viahate: rubrNoted
[5:46:58] predictions subscriber partner Temiree: stop writing in my skull 
[5:47:05] vip premium Monopool: jmikeNoted
[5:47:06] predictions subscriber JoGoBeans: jmikeNoted
[5:47:07] FluffaWonderfluff: Old CGI PogChamp
[5:47:07] predictions subscriber partner Temiree: hyenaNote
[5:47:26] vip premium fealiksg: this is neat 
[5:47:26] glhf-pledge empanadas_in_pinatas: @Temiree grabs hammer and chisel instead 
[5:47:31] porig: papercore 
[5:47:32] Garfsune_Miku: 🗒️ 
[5:47:36] subscriber twitch-recap-2023 ocarina_boy: catJAMPARTY
[5:47:38] predictions subscriber partner Temiree: @empanadas_in_pinatas NOOOOO temireSadEgg
[5:48:19] lego_palpatine: is there more gongo? 
[5:48:25] SirLurksaIot: jrjMaxiNotes jrjMaxiNotes jrjMaxiNotes
[5:48:27] subscriber glitchcon2020 LnLessa: paper 
[5:48:34] subscriber glitchcon2020 LnLessa: jmikeNoted
[5:48:59] broadcaster turbo GreatSphynx: yes 
[5:49:01] broadcaster turbo GreatSphynx: 1 more hour 
[5:49:10] lego_palpatine: :O
[5:49:15] ScrapyardSatyr: PridePog
[5:49:22] vip premium lmaoboat: Ratchetstep 
[5:49:22] turbo Navitron: Navitron subscribed at Tier 1. They've subscribed for 20 months! 
[5:49:22] predictions subscriber snosa: :o
[5:49:38] broadcaster turbo GreatSphynx: ty navitron 
[5:49:40] turbo Navitron: Gongussy 
[5:49:45] moderator founder turbo Dragoneye77: will osmo awaken in an hour 
[5:49:50] moderator founder turbo Dragoneye77: find out next time on gongo ball z 
[5:49:51] broadcaster turbo GreatSphynx: hes awake 
[5:49:53] broadcaster turbo GreatSphynx: hes on my desk rn 
[5:49:58] moderator founder turbo Dragoneye77: but has he interrupted the gongo
[5:50:01] broadcaster turbo GreatSphynx: i have been shooting nerf darts for him 
[5:50:01] superultracombo-2023 careful_crab: S O O N 
[5:50:05] superultracombo-2023 careful_crab: O 
[5:50:11] superultracombo-2023 careful_crab: N 
[5:50:18] subscriber twitch-recap-2023 ocarina_boy: if it's gonna be another hour then I should sleep lmao, nini chat, thanks for the gongo Sphynx osmoPat jmikeMask Sleepo
[5:50:32] predictions subscriber snosa: Sleepo nini 
[5:50:34] moderator founder turbo Dragoneye77: sphynx arent yo afraid osmos going learn 
[5:50:39] moderator founder turbo Dragoneye77: and then he'll shoot a gun at you 
[5:50:41] subscriber Hexagon_2: dumbmo1Emerge gn 
[5:50:48] subscriber twitch-recap-2023 ocarina_boy: osmo will learn the way of gun 
[5:50:58] subscriber twitch-recap-2023 ocarina_boy: he will be unstoppable 
[5:51:08] predictions subscriber snosa: catPls
[5:51:24] predictions vip GodliestCat64: @ocarina_boy greats8Daxmug Goodnight 
[5:51:28] turbo Navitron: greats8JAM
[5:51:30] moderator founder turbo Dragoneye77: @GreatSphynx have you introduced osmo to other people at all 
[5:51:38] moderator founder turbo Dragoneye77: like recently 
[5:51:43] broadcaster turbo GreatSphynx: one of my friends has come over a couple times 
[5:51:51] broadcaster turbo GreatSphynx: but no not really he only knows me 
[5:51:51] vip twitch-recap-2023 viahate: catJamrgb catJamrgb
[5:51:57] broadcaster turbo GreatSphynx: which is why he follows me everywhere and always sleeps next to me 
[5:52:03] moderator founder turbo Dragoneye77: aw 
[5:52:07] predictions subscriber snosa: sweet 
[5:52:08] moderator founder turbo Dragoneye77: he thinks your a big cat 
[5:52:09] predictions deworming_in_progress: osmo does not know the outside world 
[5:52:34] broadcaster turbo GreatSphynx: osmoD
[5:52:53] budderdog_: osmoPat
[5:52:55] subscriber twitch-recap-2023 plumblossomrobot: dataSleep osmoBlep
[5:52:58] vip premium plorf: this kinda sounhds like iglooghost 
[5:52:59] moderator founder turbo Dragoneye77: is he meowing more or nah 
[5:53:23] broadcaster turbo GreatSphynx: no he still does not meow
[5:53:32] broadcaster turbo GreatSphynx: its sega bodega 
[5:53:42] moderator founder turbo Dragoneye77: odd cat 
[5:53:45] broadcaster turbo GreatSphynx: sorta same realm of genre 
[5:53:46] moderator founder turbo Dragoneye77: osmoBlep
[5:53:46] vip premium plorf: oh shit 
[5:53:50] vip premium plorf: i havent heard that name in a while 
[5:53:51] predictions Origfx: ONOTrip morego 
[5:53:51] vip premium plorf: hes cool 
[5:54:31] predictions subscriber snosa: OYTrip
[5:54:34] twitch-recap-2023 Karmalsauce: OYTrip
[5:54:38] subscriber twitch-recap-2023 plumblossomrobot: OYTrip
[5:54:38] Takamatsu2: OYTrip
[5:54:49] turbo Navitron: OYTrip
[5:54:56] turbo Navitron: OTrip
[5:54:57] moderator founder turbo Dragoneye77: S 
[5:54:57] twitch-recap-2023 Karmalsauce: OYOTrip
[5:54:59] predictions subscriber JoGoBeans: catPls
[5:55:01] vip premium fealiksg: :)
[5:55:03] predictions Origfx: OTrip
[5:55:10] vip Snudl: LeDoritoFace
[5:55:12] predictions vip GodliestCat64: greats8YoTrip
[5:55:17] subscriber Hexagon_2: greats8OTrip
[5:55:20] predictions Origfx: ONOTrip
[5:55:20] cheapsushidragon: oboi herewego 
[5:55:23] predictions subscriber snosa: OTrip
[5:55:23] vip premium plorf: OYOTrip
[5:55:24] GUY_KAZAMA: greats8YoTrip
[5:55:24] predictions Origfx: catPls
[5:55:26] subscriber premium Fecal_Sauce: Sorry If I missed the thanks. Thanks for making a fun way to spend the night @greatsphynx 
[5:55:36] Garfsune_Miku: greats8YoTrip WOOOOOOAH 
[5:55:38] Takamatsu2: woah i remember seeing that box 
[5:55:39] predictions vip GodliestCat64: Oh man I just shared this one the other day 
[5:55:40] broadcaster turbo GreatSphynx: np ty for watching 
[5:55:40] vip twitch-recap-2023 viahate: kansas OYOTrip
[5:55:55] turbo Navitron: ONOTrip 20 
[5:55:57] predictions subscriber snosa: ONOTrip
[5:55:57] vip premium lmaoboat: Sphynx, have we watched all of that 3d series where half of it is like precaps and recaps 
[5:56:01] moderator founder turbo Dragoneye77: YOOO 
[5:56:04] moderator founder turbo Dragoneye77: SKIBIDI MAN 
[5:56:08] broadcaster turbo GreatSphynx: which one 
[5:56:16] twitch-recap-2023 Karmalsauce: picBust
[5:56:19] moderator founder turbo Dragoneye77: the tv head 
[5:56:19] Takamatsu2: picBust
[5:56:20] subscriber Hexagon_2: greats8Bruh
[5:56:22] predictions subscriber snosa: picBust
[5:56:23] vip premium lmaoboat: The one with all the songs and the gormless kid watching TV 
[5:56:24] predictions bits nyeaszel: picBust
[5:56:26] subscriber twitch-recap-2023 plumblossomrobot: picBust
[5:56:28] vip Snudl: picBust
[5:56:31] broadcaster turbo GreatSphynx: oh yeah all the ones that exist 
[5:56:35] broadcaster turbo GreatSphynx: there are supposed to be like 
[5:56:36] broadcaster turbo GreatSphynx: 13 
[5:56:40] broadcaster turbo GreatSphynx: but only like 4 have been found 
[5:56:41] predictions Origfx: I saw a skibidi toilet figure gacha box in a toy shop here docDis
[5:56:42] subscriber glitchcon2020 LnLessa: picBust
[5:56:44] twitch-recap-2023 Karmalsauce: jarJAM
[5:56:45] predictions vip GodliestCat64: catPls
[5:56:46] vip premium fealiksg: YEAH 
[5:56:48] Garfsune_Miku: Crosher
[5:56:48] predictions subscriber snosa: aaaaaaaaaaaaa 
[5:56:49] predictions subscriber JoGoBeans: catPls
[5:56:51] vip premium fealiksg: THERE HE IS 
[5:56:52] predictions bits nyeaszel: catPls
[5:56:53] subscriber robotsnake: Beast? 
[5:56:54] predictions thetwitch3r: catPls
[5:56:56] predictions Origfx: Funnywhitecat5
[5:56:58] premium UroWasHere: vampire drip 
[5:57:01] predictions subscriber twitch-recap-2023 n0tthedoctor: greats8JAM greats8JAM greats8JAM greats8JAM
[5:57:01] vip premium plorf: KING COOL 
[5:57:04] GUY_KAZAMA: it's king cool greats8YoTrip
[5:57:07] predictions Origfx: GREY LENO? 
[5:57:09] turbo TrueBlueVenue: Good morning Gongo 
[5:57:11] predictions subscriber snosa: real 
[5:57:12] vip premium fealiksg: Sleepo
[5:57:12] predictions deworming_in_progress: me 
[5:57:13] moderator founder turbo Dragoneye77: ResidentSleeper
[5:57:14] Garfsune_Miku: just a sleepi lil guy 
[5:57:16] vip premium lmaoboat: I would like to stand somewhere not by that guy 
[5:57:17] predictions bits nyeaszel: ResidentSleeper
[5:57:19] subscriber twitch-recap-2023 plumblossomrobot: ResidentSleeper
[5:57:21] broadcaster turbo GreatSphynx: btw yes betters won 
[5:57:28] broadcaster turbo GreatSphynx: like a min ago 
[5:57:35] predictions subscriber snosa: NOOOO
[5:57:35] predictions subscriber twitch-recap-2023 Piyokopyo: YEEEAHH 
[5:57:36] broadcaster turbo GreatSphynx: when like the background turned black 
[5:57:37] predictions Origfx: odoNo damn you osmo 
[5:57:38] twitch-recap-2023 Karmalsauce: monkaS
[5:57:40] premium UroWasHere: oh no 
[5:57:44] predictions bits nyeaszel: SKIBIDI 
[5:57:46] broadcaster turbo GreatSphynx: osmo like climbed full up onto the gongo gear and hit some levers 
[5:57:49] broadcaster turbo GreatSphynx: and was trying to get like 
[5:57:54] predictions Origfx: odoNo my points.... are GONE NOOOO
[5:57:56] predictions subscriber JoGoBeans: anyone else get a DM from gustave_ricardot? 
[5:57:56] broadcaster turbo GreatSphynx: a piece of plastic that was hanging off the shelf above the gongo gear 
[5:57:58] predictions vip GodliestCat64: greats8YoTrip
[5:57:59] subscriber twitch-recap-2023 plumblossomrobot: lmao 
[5:57:59] broadcaster turbo GreatSphynx: i guess it was shiny 
[5:58:01] predictions subscriber snosa: lol 
[5:58:04] predictions bits nyeaszel: lol 
[5:58:04] budderdog_: good boy osmo osmoD
[5:58:12] vip premium fealiksg: oh his eyebrows ourple 
[5:58:16] subscriber JoGoBeans: thanks osmo OYOTrip
[5:58:35] subscriber twitch-recap-2023 plumblossomrobot: lol this happened four times? 
[5:58:39] twitch-recap-2023 Karmalsauce: D:
[5:58:49] subscriber twitch-recap-2023 n0tthedoctor: greats8Bermus
[5:58:49] cheapsushidragon: catOK
[5:58:58] broadcaster turbo GreatSphynx: he has been adventurous all day today 
[5:59:05] broadcaster turbo GreatSphynx: i didnt know he was going for the plastic thing 
[5:59:15] broadcaster turbo GreatSphynx: but i was cropping the stream and getting stuff started when he climbed up 
[5:59:21] vip premium fealiksg: he's a brave boy 
[5:59:23] subscriber snosa: osmoLick
[5:59:24] broadcaster turbo GreatSphynx: i have been doing stuff to disuade him but he keeps doing it 
[5:59:30] broadcaster turbo GreatSphynx: and then gets really mad when i pick him up and move him 
[5:59:33] turbo Navitron: sweatFrog
[5:59:38] broadcaster turbo GreatSphynx: i think he just wants me to play with him 
[5:59:41] subscriber snosa: lil force of nature 
[5:59:42] broadcaster turbo GreatSphynx: which im gonna do during this 
[5:59:43] Creatures_Features: big mood 
[5:59:55] broadcaster turbo GreatSphynx: sometimes shooting darts aint enough 
[6:00:01] subscriber twitch-recap-2023 plumblossomrobot: osmoStare
[6:00:01] subscriber twitch-recap-2023 Piyokopyo: osmoD can't control me 
[6:00:09] vip GodliestCat64: osmoD <- Requires playtime 
[6:00:25] subscriber snosa: gulp 
[6:00:31] subscriber twitch-recap-2023 plumblossomrobot: godGrabbingYouL osmoD godGrabbingYouR
[6:00:55] superultracombo-2023 careful_crab: Thought this was Jimmy neutron for a sec 
[6:01:05] subscriber snosa: slurp 
[6:01:32] vip GodliestCat64: catPls
[6:01:38] subscriber snosa: (real) 
[6:01:38] cheapsushidragon: BedgeCat
[6:01:41] Origfx: catPls
[6:01:48] turbo Navitron: D:
[6:01:50] subscriber snosa: D:
[6:01:56] superultracombo-2023 careful_crab: D:
[6:01:57] subscriber Hexagon_2: greats8OdoNo
[6:02:00] subscriber snosa: oh i love him 
[6:02:12] turbo TrueBlueVenue: What year did they say this was from? 
[6:02:12] subscriber snosa: catPls
[6:02:27] vip premium fealiksg: bark 
[6:02:29] vip GodliestCat64: bark 
[6:02:33] subscriber twitch-recap-2023 Piyokopyo: Bark. 
[6:02:34] vip premium lmaoboat: barfk barfk 
[6:02:40] subscriber snosa: bark. bark 
[6:02:43] turbo TrueBlueVenue: bark :|
[6:02:58] twitch-recap-2023 qu4ck__: OhMyDog
[6:03:22] vip premium fealiksg: Wawa
[6:03:24] subscriber JoGoBeans: catPls
[6:03:27] subscriber snosa: Wawa
[6:03:46] subscriber twitch-recap-2023 Piyokopyo: Why that pov 
[6:03:47] broadcaster turbo GreatSphynx: https://cdn.discordapp.com/attachments/977044292893806672/1189195107950407821/20231225_230848.jpg?ex=659d473f&is=658ad23f&hm=c2c13a30633956f373ed7d5839d96011e1a95efafffbec1ce1644324b9264bba& 
[6:03:47] subscriber snosa: NOOOO
[6:03:48] vip premium fealiksg: NO 
[6:03:52] twitch-recap-2023 Karmalsauce: HUHH
[6:03:57] subscriber twitch-recap-2023 n0tthedoctor: POOSHI 
[6:04:01] subscriber snosa: activated 
[6:04:01] vip Snudl: siskoNo
[6:04:01] budderdog_: osmoD
[6:04:02] subscriber JoGoBeans: @GreatSphynx your cat looks so fluffy 
[6:04:06] vip artist-badge Raxxmus: shiny cat 
[6:04:14] broadcaster turbo GreatSphynx: He is 
[6:04:14] subscriber snosa: greats8Osmopat
[6:04:19] subscriber Hexagon_2: osmo so cute 
[6:04:21] premium UroWasHere: bark for me moon2A
[6:04:22] turbo Navitron: performance anxiety odoNo
[6:04:22] subscriber glitchcon2020 LnLessa: why he not ourple 
[6:04:26] vip twitch-recap-2023 viahate: crumpSee osmoStare
[6:04:27] subscriber twitch-recap-2023 plumblossomrobot: osmoPat
[6:04:31] broadcaster turbo GreatSphynx: False color osmo 
[6:04:34] twitch-recap-2023 WolfzenSkiigh: Osmo, entity of darkness 
[6:04:34] vip premium fealiksg: omo look so soft 
[6:04:35] turbo TrueBlueVenue: You have a cosmic cute kitty, Sphynx 
[6:04:51] subscriber Hexagon_2: greats8PEPPERONI
[6:04:54] no_video QuickSickness: hmm 
[6:05:06] twitch-recap-2023 qu4ck__: OhMyDog
[6:05:12] vip GodliestCat64: greats8Osmopat
[6:05:13] vip premium plorf: 🗿 
[6:05:13] broadcaster turbo GreatSphynx: I love this one 
[6:05:26] vip premium lmaoboat: 🗿 
[6:05:27] twitch-recap-2023 Karmalsauce: 🗿 
[6:05:28] vip GodliestCat64: 🗿 
[6:05:44] premium UroWasHere: biboo 
[6:05:49] subscriber snosa: 🗿 
[6:06:05] bits nyeaszel: silver surfer? 
[6:06:10] subscriber snosa: bah 
[6:06:29] twitch-recap-2023 qu4ck__: 🗿 
[6:06:30] bits nyeaszel: tendiAAH
[6:06:33] deworming_in_progress: odoSoyL
[6:06:40] vip GodliestCat64: 🗿 Your stomp was poorly executed 
[6:06:44] broadcaster turbo GreatSphynx: of all the cgi videos i show this one and like animusic 1 are the two i watched obssesively as a kid, i still havce the tapes and dvds for both 
[6:07:05] subscriber snosa: aw that's awesome 
[6:07:06] twitch-recap-2023 WolfzenSkiigh: that's sick 
[6:07:07] Wisemann167: earth benders! 
[6:07:12] bits nyeaszel: awesome collection 
[6:07:26] subscriber snosa: zzooTrip
[6:08:05] subscriber snosa: deadass
[6:08:10] vip GodliestCat64: Having a tape of this one would be sick 
[6:08:13] subscriber snosa: wawawawa 
[6:08:15] bits nyeaszel: hitMe
[6:08:23] vip Snudl: Wawa TrumpetTime
[6:08:26] Magolor: strangely hard song 
[6:08:32] broadcaster turbo GreatSphynx: I love these ones that are scanned to film insteD of tape 
[6:08:33] turbo TrueBlueVenue: It's cool just how much early CG was being experimented with, like now the age of it is its own style 
[6:08:38] subscriber snosa: !!! 
[6:08:40] Origfx: popCat wawawa 
[6:08:40] turbo TrueBlueVenue: Like that Digital Circus 
[6:08:57] Origfx: catPls
[6:09:00] subscriber JoGoBeans: catJAMM
[6:09:06] vip premium fealiksg: yeah steal his stuff 
[6:09:10] premium UroWasHere: D:
[6:09:39] premium UroWasHere: He's so hot now 
[6:09:41] Creatures_Features: Clap
[6:09:41] subscriber snosa: Clap
[6:09:45] twitch-recap-2023 WolfzenSkiigh: Identity theft Clap
[6:09:59] Creatures_Features: monkaS
[6:10:12] subscriber snosa: RAGEY
[6:10:16] twitch-recap-2023 Karmalsauce: BERMAD
[6:10:18] subscriber Hexagon_2: haeron2Manos
[6:10:29] Creatures_Features: when lil bro wants to play big bro's gameboy 
[6:10:31] Origfx: catPls
[6:10:50] subscriber JoGoBeans: catJAM
[6:11:03] Origfx: sweatFrog
[6:11:34] twitch-recap-2023 Karmalsauce: odoNo
[6:11:36] Creatures_Features: T_T 
[6:11:43] premium UroWasHere: back to being an L card 
[6:11:44] deworming_in_progress: is this the rick and morty song 
[6:11:44] turbo TrueBlueVenue: :(
[6:11:46] no_video QuickSickness: Rick and Morty music? 
[6:11:50] subscriber JoGoBeans: this chord progression sounds familiar 
[6:11:55] subscriber snosa: !!!! 
[6:11:58] superultracombo-2023 careful_crab: Oh God 
[6:12:15] twitch-recap-2023 Karmalsauce: ultrawideDoc
[6:12:19] subscriber snosa: ultrawideDoc
[6:12:23] twitch-recap-2023 kozi_the_poopy_prince: STAR TWEK? 
[6:12:31] vip premium fealiksg: ultrawideDoc
[6:12:38] premium UroWasHere: is this the lizard sex episode? 
[6:12:39] subscriber snosa: bounceDoc
[6:13:23] BeamingButt: mikeliveSlippy
[6:13:54] subscriber snosa: NOOOO
[6:13:56] broadcaster turbo GreatSphynx: Didn't even look at the gold record geneSad
[6:14:02] twitch-recap-2023 kozi_the_poopy_prince: LULW 
[6:14:11] subscriber Hexagon_2: lolosSpacepup
[6:14:13] twitch-recap-2023 Karmalsauce: Uhhh
[6:14:13] premium UroWasHere: WhySoSerious
[6:14:18] bits nyeaszel: catJAM
[6:14:20] subscriber JoGoBeans: wtf happened to Blue's Clues 
[6:14:28] twitch-recap-2023 qu4ck__: @JoGo_ crack 
[6:14:43] subscriber snosa: rurururu 
[6:14:51] twitch-recap-2023 qu4ck__: @JoGo_ and a bit of meth 
[6:14:51] turbo TrueBlueVenue: sniffa 
[6:15:12] no_video QuickSickness: there was no flea 
[6:15:12] premium UroWasHere: moon2JOKA all it takes is one bad walkie 
[6:15:22] no_video QuickSickness: he was just deranged and high 
[6:15:29] twitch-recap-2023 qu4ck__: D:
[6:15:39] vip premium fealiksg: violence 
[6:15:40] vip Snudl: WHAT
[6:15:41] twitch-recap-2023 kozi_the_poopy_prince: Fleas dun have wings jmikeDinking
[6:15:45] vip premium fealiksg: NOOOOO 
[6:15:48] subscriber Creatures_Features: F 
[6:15:53] subscriber JoGoBeans: tendiAAH
[6:15:54] bits nyeaszel: tetanus moment 
[6:16:07] subscriber Jablabber: Merry gongmas 
[6:16:15] vip premium fealiksg: marry gongo
[6:16:34] vip premium fealiksg: wideVIBE
[6:16:34] vip Snudl: Mike Oldfield greats8YoTrip
[6:16:35] twitch-recap-2023 Karmalsauce: catJAMM
[6:16:36] broadcaster turbo GreatSphynx: Love this song 
[6:16:39] Wisemann167: wideVIBE
[6:16:44] bits nyeaszel: zzooTrip
[6:16:44] vip premium plorf: wideVIBE
[6:16:46] subscriber snosa: wideVIBE
[6:16:48] premium UroWasHere: Californication moment 
[6:16:52] vip Snudl: wideVIBE
[6:16:52] subscriber Creatures_Features: wideVIBE
[6:16:55] subscriber JoGoBeans: Drakengard hidden ending OYOTrip
[6:16:59] vip premium fealiksg: burning 
[6:17:08] subscriber snosa: melting 
[6:17:13] bits nyeaszel: wideVIBE
[6:17:41] superultracombo-2023 careful_crab: We should watch speed 
[6:17:43] DaWhatTheFox: zzooTrip
[6:17:45] turbo TrueBlueVenue: wideVIBE
[6:17:48] subscriber JoGoBeans: wow it really is Drakengard 
[6:17:58] twitch-recap-2023 WolfzenSkiigh: m e l t i n g 
[6:17:59] Origfx: catBlink
[6:18:08] subscriber JoGoBeans: wideVIBE
[6:18:09] twitch-recap-2023 Karmalsauce: wideVIBE
[6:18:14] vip premium fealiksg: Lounging i love this one 
[6:18:17] subscriber snosa: zzooTrip
[6:18:25] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: "wait guys, i think we took the wrong turn" 
[6:18:33] Magolor: why is the music so good??? 
[6:18:34] grandfatigue: this kills the bike 
[6:18:35] vip premium fealiksg: aaaaa 
[6:18:38] subscriber snosa: aaaaa 
[6:18:41] vip premium plorf: OYOTrip
[6:18:46] BeamingButt: retroi3Dance
[6:19:00] broadcaster turbo GreatSphynx: Cuz its Mike oldfield 
[6:19:06] subscriber snosa: wideVIBE
[6:19:17] dresden81: Gooootan 
[6:19:29] vip premium plorf: !god 
[6:19:29] moderator partner Nightbot: gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog gerbPog
[6:19:29] DaWhatTheFox: OYOTrip
[6:19:41] vip twitch-recap-2023 viahate: Pepechill
[6:19:43] Wisemann167: tetris effect looking background 
[6:19:45] vip premium lmaoboat: I really dig tinny voice effects in songs 
[6:19:47] bits nyeaszel: zzooTrip
[6:19:50] broadcaster turbo GreatSphynx: This whole album is pretty good 
[6:19:56] vip premium fealiksg: da dwagon greats8YoTrip
[6:20:00] vip premium plorf: yeah i should listen to it more 
[6:20:09] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: wtf 
[6:20:21] BeamingButt: i never hated mike oldfield, but didnt seek out his music either. This is nice 
[6:20:25] bits nyeaszel: loving the cinematograpgy in this 
[6:20:26] twitch-recap-2023 Karmalsauce: zzooTrip
[6:20:31] Origfx: w! zzooTrip
[6:20:38] away0404: zzooTrip should have brought sunglasses 
[6:20:43] BeamingButt: Clap
[6:20:43] vip premium lmaoboat: There's a really good remix of the Pokemon TCG Gameboy game psychic gym theme that uses a radio-chattery effect 
[6:20:46] subscriber JoGoBeans: monkaS
[6:20:50] vip GodliestCat64: OTrip
[6:20:50] Origfx: jarJAM
[6:20:51] DaWhatTheFox: funnywhitecat5
[6:21:04] Origfx: lockstep if real 
[6:21:06] vip premium fealiksg: oh yeah this one lol 
[6:21:08] subscriber JoGoBeans: Is that Hitler top right 
[6:21:23] BeamingButt: Fatpies? 
[6:21:25] vip premium plorf: HE SPITTIN NOTHIN 
[6:21:25] DaWhatTheFox: OYTrip
[6:21:30] ScrapyardSatyr: Buhh
[6:21:35] subscriber JoGoBeans: I agree 
[6:21:36] Magolor: Henceforth 
[6:21:41] vip GodliestCat64: YOU'RE COOKIN BUT WE'RE NOT EATIN 🗣 FIRE FIRE E 
[6:21:52] twitch-recap-2023 joltick2: wheras 
[6:21:56] DaWhatTheFox: OYOTrip
[6:21:57] subscriber JoGoBeans: D:
[6:22:00] BeamingButt: Only logical 
[6:22:02] vip premium plorf: !frasier 
[6:22:02] moderator partner Nightbot: odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap odoLUL Clap
[6:22:06] turbo TrueBlueVenue: He's cooking but there's nothing in the pot 
[6:22:07] vip premium fealiksg: Clap
[6:22:09] FluffaWonderfluff: Clap
[6:22:09] subscriber JoGoBeans: OYOTrip Clap
[6:22:10] no_video QuickSickness: yeah I'm thinking this guy is based 
[6:22:11] vip GodliestCat64: Clap
[6:22:12] twitch-recap-2023 joltick2: o7
[6:22:12] bits nyeaszel: graduation song lol 
[6:22:13] subscriber Hexagon_2: Nice! 
[6:22:16] Tiphias: He's saying what we're all thinking 
[6:22:16] Magolor: Dragon Quest ass music 
[6:22:18] bits nyeaszel: Clap
[6:22:21] vip premium plorf: Corb
[6:22:24] DaWhatTheFox: Corb
[6:22:46] BeamingButt: Little big planet? 
[6:23:07] vip GodliestCat64: Corb
[6:23:08] no_video QuickSickness: me rocks on triangle win 
[6:23:20] Origfx: NOOOO
[6:23:23] vip GodliestCat64: Pullin up in the grug machine 
[6:23:35] BeamingButt: why they fuckn with the sony playstation controller symbols? 
[6:23:35] Origfx: odoNo ded 
[6:23:36] vip premium plorf: cromagnon cybertruck 
[6:23:58] vip premium plorf: you'll never guess what this one is 
[6:24:02] no_video QuickSickness: circle just fad, grug invest in hexagon 
[6:24:07] dresden81: Mercury monkaS
[6:24:12] turbo TrueBlueVenue: booba? 
[6:24:27] vip premium plorf: that's right, BMW 
[6:24:27] BeamingButt: mercury you leave that pretty lady alone 
[6:24:28] DaWhatTheFox: lol 
[6:24:28] Wisemann167: LUL
[6:24:32] subscriber robotsnake: LOL 
[6:24:34] premium UroWasHere: AWOOO 
[6:24:40] turbo TrueBlueVenue: I was just thinking that looked like a commercial LUL
[6:24:45] BeamingButt: she didnt mean to break the thermometer. She was tripping balls 
[6:24:58] premium UroWasHere: Minecraft zombie noise 
[6:25:19] vip premium lmaoboat: Mercury compounds can be some of the most fucked substances. 
[6:25:28] BeamingButt: its almost zelda breath of the wild 
[6:25:41] subscriber snosa: awooo 
[6:25:49] subscriber premium Yeven_Fox: socksAwoo
[6:25:54] vip premium lmaoboat: Like I read about that one lady who had a drop of mercury-somethign seep through her latex glove and into her skin, and it was basically like dying of acute radiation 
[6:26:05] vip premium plorf: wow its so realistic 
[6:26:52] vip twitch-recap-2023 viahate: fairyl1Knife
[6:26:53] premium UroWasHere: the weapons seek the food monkaS
[6:27:08] vip premium fealiksg: gross put that back 
[6:27:14] no_video QuickSickness: meat? 
[6:27:35] subscriber snosa: sweatFrog
[6:27:41] subscriber Jablabber: SCARY FORK AAAHHHHH 
[6:27:47] twitch-recap-2023 kozi_the_poopy_prince: Little Nightmares? 
[6:27:55] BeamingButt: i get it. Sometimes you just want to do bad things to a peach. Preferably over a sink 
[6:28:02] vip premium plorf: GLEEBING
[6:28:03] FluffaWonderfluff: I've never seen early CGI stuff mix in actual camera work, it's pretty neat 
[6:28:04] DaWhatTheFox: pregante 
[6:28:10] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: gregnant 
[6:28:22] subscriber snosa: pegat 
[6:28:42] BeamingButt: Ecision 
[6:28:44] premium UroWasHere: consultants room 
[6:28:54] BeamingButt: oh
[6:29:08] vip premium plorf: SCP 
[6:29:18] twitch-recap-2023 qu4ck__: THE BOX 
[6:29:20] vip premium plorf: this is like the vending machine one 
[6:29:25] vip premium lmaoboat: Still better than the presidental astrologer 
[6:29:35] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: greats8OTrip
[6:29:43] vip GodliestCat64: i love the card contraption 
[6:29:46] twitch-recap-2023 qu4ck__: OYOTrip
[6:29:55] premium UroWasHere: AI in the 1900s 
[6:29:57] vip premium plorf: boyoyong 
[6:29:59] twitch-recap-2023 qu4ck__: boioioiong 
[6:30:04] Origfx: OTrip
[6:30:17] subscriber snosa: lol 
[6:30:22] twitch-recap-2023 qu4ck__: your mether 
[6:30:26] vip GodliestCat64: catJammingPolitely
[6:30:31] Origfx: catPls
[6:30:34] premium UroWasHere: NotLikeThis
[6:30:35] subscriber snosa: catJammingPolitely
[6:30:39] twitch-recap-2023 Karmalsauce: jarJAM
[6:30:43] vip premium plorf: jarJAM
[6:30:48] broadcaster turbo GreatSphynx: Catj 
[6:30:48] cheapsushidragon: ratJAM ratJAM ratJAM ratJAM
[6:30:51] broadcaster turbo GreatSphynx: Fuk 
[6:30:55] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: greats8JAM
[6:31:02] bits-leader bizwizard667: bounceDok
[6:31:02] subscriber snosa: so true 
[6:31:05] KingCoughin: catJAMM PianoTime
[6:31:27] subscriber Hexagon_2: dumbmo1Dance
[6:31:31] vip twitch-recap-2023 viahate: catJAMM
[6:31:36] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: madmiePo
[6:31:52] bits-leader bizwizard667: bounceDok GuitarTime
[6:32:02] vip premium plorf: Tasty
[6:32:03] premium UroWasHere: an oreo 
[6:32:11] turbo TrueBlueVenue: Robo wants 
[6:32:12] KingCoughin: hydrox PogChamp
[6:32:15] cheapsushidragon: Hue 
[6:32:19] DaWhatTheFox: oreo Pog 
[6:32:29] bits-leader bizwizard667: odoKEK scoreo 
[6:32:32] vip premium fealiksg: hehe 
[6:32:39] twitch-recap-2023 Your_New_Adoptive_Parents: lol! 
[6:32:50] Magolor: Ultrakill soundeffects be like 
[6:32:52] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: my local shop sells a knock off version called "Ohio" 
[6:32:58] dresden81: eat oreos daxMug
[6:33:11] twitch-recap-2023 kozi_the_poopy_prince: @specialagentfoxmulderfbi KEKW 
[6:33:11] subscriber snosa: bloop 
[6:33:11] FluffaWonderfluff: @SpecialAgentFoxMulderFBI Robo wants an Ohio 
[6:33:14] vip premium fealiksg: i'd try an ohio 
[6:33:20] turbo TrueBlueVenue: Ashens once covered Oreo knockoffs and one of them were called "Borneos" 
[6:33:24] premium UroWasHere: buzz fight year 
[6:33:43] critatonic: @truebluedeuce dude I love that payload map 
[6:33:44] turbo Navitron: yuzuNotLikeThis
[6:33:44] vip Snudl: !spacewar 
[6:33:45] moderator partner Nightbot: baldlyGo boldlyGo boldlyGo baldlyGo baldlyGo baldlyGo boldlyGo boldlyGo greats8BeamR greats8BeamL greats8BeamR greats8BeamL greats8BeamR greats8BeamL Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion Explosion 🪐 ⭐ 🌟 ☀ ☄ 🪐 ⭐ 🌟 ☀ ☄ 🪐 ⭐ 🌟 ☀ ☄ Defiant deepSpin deepSpin Defiant deepSpin deepSpin Defiant deepSpin Defiant
[6:33:47] vip premium lmaoboat: Fucked up in the crib eating cream betweens 
[6:33:47] vip truthandpenitence: new Squadron 42 trailer just dropped 
[6:33:52] dresden81: Whos alarm clock is going off? 
[6:34:50] subscriber snosa: bwoop 
[6:35:01] vip premium fealiksg: i love silly cgi machines 
[6:35:10] turbo TrueBlueVenue: Is there an official schedule or discord for Gongo? 
[6:35:22] vip premium lmaoboat: !discord 
[6:35:23] moderator partner Nightbot: u can join the discord 4 notifs and emotes but u cant talk https://discord.gg/yRahnWpyDa 
[6:35:33] premium UroWasHere: Runescape monkaS
[6:35:38] vip premium plorf: OYOTrip
[6:35:39] vip premium fealiksg: YEAH 
[6:35:41] turbo Navitron: greats8JAM
[6:35:41] subscriber snosa: ooooooooooo 
[6:35:42] twitch-recap-2023 Karmalsauce: jarJAM
[6:35:43] grandfatigue: catJAMM
[6:35:44] vip premium lmaoboat: FREAK 
[6:35:46] dresden81: oh I remember this LUL
[6:35:47] subscriber snosa: aaaaaooo babyyyy 
[6:35:47] Origfx: Funnywhitecat5
[6:35:48] GUY_KAZAMA: catPls
[6:35:49] subscriber Hexagon_2: greats8OTrip
[6:35:50] cheapsushidragon: Grey Leno Returns 
[6:35:53] premium Septicpunk_: oh shit, gongo still rollin? what'd I miss 
[6:35:53] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: sarabe6Dance
[6:35:54] bits-leader bizwizard667: Chadley
[6:35:54] vip twitch-recap-2023 viahate: this guy RAGEY
[6:36:00] twitch-recap-2023 kozi_the_poopy_prince: jmikeSquandance jmikeSquandance jmikeSquandance
[6:36:01] GUY_KAZAMA: he reminds me of Max Headroom 
[6:36:01] broadcaster turbo GreatSphynx: When I was a kid I couldn't tell if this guy was supposed to be cgi 
[6:36:02] subscriber snosa: jarJAM
[6:36:03] vip premium fealiksg: Yeat
[6:36:05] premium UroWasHere: phiame1Lightsticks
[6:36:14] dannysol_: This was one of the first gongos I watched when I found this stream 
[6:36:17] twitch-recap-2023 Karmalsauce: baldlyGo
[6:36:19] bits-leader bizwizard667: john travolta 
[6:36:20] vip Snudl: catJammingPolitely
[6:36:22] cheapsushidragon: funnywhitecat5 funnywhitecat5
[6:36:23] bits nyeaszel: daxMug
[6:36:26] broadcaster turbo GreatSphynx: This is a gongo classic 
[6:36:32] twitch-recap-2023 kozi_the_poopy_prince: @greatsphynx LUL
[6:36:36] bits nyeaszel: funnywhitecat5
[6:36:37] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: the OG GigaChad? 
[6:36:43] vip premium plorf: plorf is gifting 10 Tier 1 Subs to GreatSphynx's community! They've gifted a total of 10 in the channel! 
[6:36:44] vip sub-gifter plorf: plorf gifted a Tier 1 sub to Danieloirse! 
[6:36:44] vip sub-gifter plorf: plorf gifted a Tier 1 sub to uforgot! 
[6:36:44] vip sub-gifter plorf: plorf gifted a Tier 1 sub to someadeez! 
[6:36:44] vip sub-gifter plorf: plorf gifted a Tier 1 sub to nickynack! 
[6:36:44] vip sub-gifter plorf: plorf gifted a Tier 1 sub to chmokaj! 
[6:36:44] vip sub-gifter plorf: plorf gifted a Tier 1 sub to kay_ann! 
[6:36:44] vip sub-gifter plorf: plorf gifted a Tier 1 sub to SteelDrake! 
[6:36:44] vip sub-gift-leader plorf: plorf gifted a Tier 1 sub to WolfzenSkiigh! 
[6:36:44] vip sub-gift-leader plorf: plorf gifted a Tier 1 sub to FurryMcMemes! 
[6:36:44] vip sub-gift-leader plorf: plorf gifted a Tier 1 sub to Briscals! 
[6:36:45] dannysol_: I stand by gongo
[6:36:45] vip premium lmaoboat: This guy freaks me out, but I love the random gun 
[6:36:52] subscriber snosa: OYOTrip plorf!!! 
[6:36:52] bits-leader bizwizard667: pspWow
[6:36:52] vip Snudl: OYOTrip
[6:36:53] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: this is scary :(
[6:36:54] broadcaster turbo GreatSphynx: Ty orf 
[6:36:55] twitch-recap-2023 Karmalsauce: ONOTrip
[6:36:55] vip sub-gift-leader plorf: merry gongmas everyone 
[6:36:55] subscriber glitchcon2020 LnLessa: wow 
[6:36:58] vip premium fealiksg: yeah plorf!!!! 
[6:36:59] broadcaster turbo GreatSphynx: Plorf 
[6:37:01] broadcaster turbo GreatSphynx: Lmao 
[6:37:02] subscriber Hexagon_2: tobsDELAMA tobsDELAMA
[6:37:03] subscriber snosa: merry gongmas 
[6:37:10] vip werewhiskey: who's this freak 
[6:37:10] bits nyeaszel: OYOTrip
[6:37:15] critatonic: bumScuz
[6:37:25] lego_palpatine: merry gongmas 
[6:37:30] subscriber twitch-recap-2023 WolfzenSkiigh: Oh dang greats8YoTrip Thank @plorf 
[6:37:30] vip sub-gift-leader plorf: im the number one king cool fan 
[6:37:37] lego_palpatine: and to all a gong night 
[6:37:38] premium UroWasHere: Duck Sim 
[6:37:39] twitch-recap-2023 kozi_the_poopy_prince: greats8Ytrip
[6:37:46] subscriber snosa: catPls
[6:37:46] vip premium fealiksg: im the second one 
[6:37:49] broadcaster turbo GreatSphynx: When I was a kid I also weirdly confused this guy with Mac tonite 
[6:37:53] vip sub-gift-leader plorf: lol 
[6:37:56] bits nyeaszel: lol 
[6:37:57] subscriber snosa: i kinda get that 
[6:38:00] bits-leader bizwizard667: true lol 
[6:38:06] twitch-recap-2023 joltick2: the moon is right 
[6:38:10] vip sub-gift-leader plorf: only 999 bloutoks OYOTrip
[6:38:10] broadcaster turbo GreatSphynx: I was a dumb 
[6:38:19] lego_palpatine: only 999 bluetawns 
[6:38:28] vip premium fealiksg: GUN 
[6:38:31] lego_palpatine: gun 
[6:38:33] KingCoughin: monkaS
[6:38:33] lego_palpatine: why 
[6:38:34] vip sub-gift-leader plorf: GET DOWN 
[6:38:39] subscriber twitch-recap-2023 WolfzenSkiigh: monkaS
[6:38:42] thedoodler303: monkaS
[6:38:43] bits nyeaszel: monkaS
[6:38:45] vip premium lmaoboat: sweatFrogM
[6:38:48] vip premium fealiksg: he wants the mic to stand by him 
[6:38:56] kephyll: HIT THE GROUND 
[6:39:01] bits-leader bizwizard667: Clap
[6:39:06] subscriber twitch-recap-2023 WolfzenSkiigh: Clap
[6:39:06] bits nyeaszel: Clap
[6:39:06] subscriber snosa: Clap
[6:39:10] GUY_KAZAMA: Clap
[6:39:11] vip premium lmaoboat: Teledildonics 
[6:39:12] subscriber snosa: catPls
[6:39:12] thedoodler303: Clap
[6:39:14] vip werewhiskey: oh this again 
[6:39:15] broadcaster turbo GreatSphynx: This is by the bingo guy 
[6:39:16] vip Snudl: daxMug Teledildonics 
[6:39:19] twitch-recap-2023 kozi_the_poopy_prince: 9ooooo 
[6:39:22] vip premium fealiksg: oh it is?? 
[6:39:23] vip sub-gift-leader plorf: hi bingo 
[6:39:24] premium UroWasHere: NODDERS 
[6:39:25] vip premium lmaoboat: Lets see how long it takes people to get the joke this time 
[6:39:28] turbo Navitron: jmikeNoted
[6:39:31] premium Septicpunk_: GET THAT CAT OFF THE KEYBOARD DAMMIT 
[6:39:33] no_video QuickSickness: interior semiotics 
[6:39:36] broadcaster turbo GreatSphynx: Yeah like 4 years prior or something 
[6:39:36] vip sub-gift-leader plorf: no 
[6:39:37] twitch-recap-2023 joltick2: grey leno? 
[6:39:37] lego_palpatine: n o 
[6:39:41] Magolor: n o 
[6:39:42] subscriber snosa: noooo 
[6:39:48] turbo Navitron: Did she just say teledildonics? 
[6:39:57] subscriber premium Yeven_Fox: Yes. Yes she did 
[6:39:57] broadcaster turbo GreatSphynx: Yes 
[6:40:06] mr_ski_: this is what our body is like with no body parts 
[6:40:10] BeamingButt: very dumb this is, but hilarious 
[6:40:11] subscriber snosa: catPls
[6:40:14] Magolor: Is this art? 
[6:40:22] premium Septicpunk_: this is what the Internet will be in 1995 
[6:40:22] lego_palpatine: this is like toy story 
[6:40:24] bits-leader bizwizard667: i have dreams like this when i get sick 
[6:40:26] vip sub-gift-leader plorf: btw thank my brother for the giftsubs lol he gave me a giftcard 
[6:40:26] KingCoughin: zzooTrip Smoke
[6:40:28] twitch-recap-2023 kozi_the_poopy_prince: Bad kangaroo! 
[6:40:35] vip premium lmaoboat: Bad Kangaroo is Rax's secret agent name 
[6:40:37] bits nyeaszel: OYOTrip
[6:41:10] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: they look nervous . hehehe 
[6:41:16] lego_palpatine: hahahaha\ 
[6:41:17] mr_ski_: oh fuuuuuuuuuuuuuck 
[6:41:20] premium UroWasHere: AI today 
[6:41:21] vip sub-gift-leader plorf: zooTrip
[6:41:27] vip artist-badge Raxxmus: thats enough boat I'm activating my sleeper agent Elusive Emu to eliminate you now 
[6:41:28] dresden81: bravo Kojima 
[6:41:38] lego_palpatine: huh 
[6:41:44] vip premium fealiksg: lol 
[6:41:46] mr_ski_: yes dude this guy gets it mannn 
[6:41:48] mr_ski_: lol 
[6:41:49] superultracombo-2023 OhGeeWhy: lmao Looney Toones did this Animation vs Animator LUL
[6:41:49] subscriber snosa: lol 
[6:41:59] BeamingButt: okay i like this more now 
[6:42:02] twitch-recap-2023 kozi_the_poopy_prince: KEKW 
[6:42:11] subscriber twitch-recap-2023 WolfzenSkiigh: LUL
[6:42:22] turbo TrueBlueVenue: Okay this is meta in a good way 
[6:42:23] premium UroWasHere: moon2H
[6:42:23] subscriber JoGoBeans: monkaS
[6:42:25] Wisemann167: monkaS run 
[6:42:28] vip sub-gift-leader plorf: catBoom
[6:42:35] subscriber twitch-recap-2023 WolfzenSkiigh: greats8Bunji
[6:42:37] subscriber JoGoBeans: D:
[6:42:41] turbo Navitron: sweatFrogM
[6:42:44] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: free willy 
[6:42:44] Magolor: philosophy in a nutshell 
[6:42:49] project_one_man_army: AI has become sentient. PULL THE PLUG 
[6:42:50] dresden81: This would be TayAI if Microsoft hadn't pulled the plug 
[6:42:53] subscriber JoGoBeans: WHAT
[6:42:58] premium hooligan_julian: Deeyuuum 
[6:43:00] premium hooligan_julian: cleean 
[6:43:02] dresden81: only this is less racist 
[6:43:06] bits-leader bizwizard667: slayers x cutscene 
[6:43:06] twitch-recap-2023 kozi_the_poopy_prince: jmikeMacalul
[6:43:09] premium UroWasHere: ourobouros monkaS ? 
[6:43:13] BeamingButt: Theories of everything recently released a 4+ hour talk of different eggheads talking about the theory of free will 
[6:43:18] BeamingButt: on youtube 
[6:43:24] superultracombo-2023 OhGeeWhy: @dresden81 who said they pulled the plug on TayAI, it may just be out of public 
[6:43:26] project_one_man_army: BASED 
[6:43:30] lego_palpatine: theres still time for it to get racist 
[6:43:32] Lyvash: This is too heavy 
[6:43:43] vip premium lmaoboat: Uzimaki Moment 
[6:43:43] vip Snudl: odokiss
[6:43:43] subscriber JoGoBeans: Understand the concept of love OYOTrip
[6:43:51] turbo TrueBlueVenue: I wonder if this started as an art piece but became this instead 
[6:44:05] Lyvash: Me? :)
[6:44:14] premium UroWasHere: Yugioh haircut 
[6:44:23] vip premium lmaoboat: A black lesbian toilet 
[6:44:28] twitch-recap-2023 kozi_the_poopy_prince: @jogo_ jmikeSquandance
[6:44:42] vip premium lmaoboat: Luanne? 
[6:44:43] BeamingButt: Accomplished animator learns the word/concept "meta". 
[6:44:43] mr_ski_: so much dmt was consumed 
[6:44:47] vip sub-gift-leader plorf: OYOTrip
[6:44:52] vip premium fealiksg: Clap
[6:44:53] vip GodliestCat64: Clap
[6:44:55] lego_palpatine: Clap
[6:44:55] turbo TrueBlueVenue: Clap
[6:44:56] no_video ParadiseWeaver: Clap
[6:44:57] Lyvash: Clap
[6:44:58] bits-leader bizwizard667: Clap
[6:44:58] mr_ski_: Clap
[6:44:58] subscriber twitch-recap-2023 WolfzenSkiigh: Clap that was cool 
[6:44:58] subscriber premium Yeven_Fox: Clap
[6:44:59] subscriber Hexagon_2: Clap
[6:44:59] vip sub-gift-leader plorf: VIBE
[6:45:01] FluffaWonderfluff: Clap
[6:45:01] subscriber snosa: Clap
[6:45:02] turbo Navitron: Clap
[6:45:03] mr_ski_: AGAIN AGAIN1 
[6:45:03] twitch-recap-2023 kozi_the_poopy_prince: Clap
[6:45:11] twitch-recap-2023 Karmalsauce: Clap
[6:45:11] vip bits-charity Maindog: My balls are cold 
[6:45:13] premium X_eroz: Clap
[6:45:13] BeamingButt: slap the bass 
[6:45:13] project_one_man_army: @mr_ski_ every time dmt is mentioned joe rogans ears perk up 
[6:45:18] Lyvash: santaPls 
[6:45:24] premium UroWasHere: Clap
[6:45:28] dannysol_: Clap thank you mister spinks sir 
[6:45:28] superultracombo-2023 ultrahuhwhat: Clap
[6:45:35] turbo TrueBlueVenue: All of those were really cool 
[6:45:38] GUY_KAZAMA: Clap
[6:45:39] Origfx: Clap
[6:45:44] vip sub-gift-leader plorf: this is such a cool varied tape 
[6:45:47] lego_palpatine: thank you mister spank 
[6:46:07] twitch-recap-2023 kozi_the_poopy_prince: Now I wanna watch Todd Rundgren's animations 
[6:46:16] broadcaster turbo GreatSphynx: CatGuitar CatGuitar
[6:46:28] KingCoughin: ty sphynx for providing insomnia content 
[6:46:29] bits-leader bizwizard667: zzooTrip
[6:46:32] turbo TrueBlueVenue: I hope I can one day be a part of a production like this, but idk where to start 
[6:46:42] vip sub-gift-leader plorf: they dont really do a lot of stuff in this vein anymore 
[6:46:54] vip sub-gift-leader plorf: not that there arent creative animators 
[6:46:55] lego_palpatine: just download blender and make whatever comes to mind 
[6:47:03] cheapsushidragon: catJAMM eGuitarTime
[6:47:04] broadcaster turbo GreatSphynx: yeah people just post on youtube now 
[6:47:08] dannysol_: kinda wish they did so we could skibidi cgi 
[6:47:22] broadcaster turbo GreatSphynx: i actually have a recent cool thing ill show i only watched part of it 
[6:47:24] broadcaster turbo GreatSphynx: thats recent 
[6:47:32] vip premium lmaoboat: @dannysol_ How about you skibdi cgDIE 
[6:47:33] twitch-recap-2023 kozi_the_poopy_prince: Oooooooh~ 
[6:47:36] vip premium fealiksg: greats8YoTrip recent 
[6:47:40] vip sub-gift-leader plorf: its like, cgi was so novel that it didnt matter how different the material is 
[6:47:41] subscriber snosa: oo 
[6:47:42] vip GodliestCat64: OYZTrip
[6:47:45] vip sub-gift-leader plorf: proper showcase 
[6:47:51] subscriber glitchcon2020 LnLessa: new gongo greats8YoTrip
[6:48:15] broadcaster turbo GreatSphynx: i think there is still some stuff sorta in this vein but its rare, i think it could make a comeback though 
[6:48:25] broadcaster turbo GreatSphynx: like stuff like off the air reminds me of minds eye stuff a bit 
[6:48:25] dannysol_: @lmaoboat im already dead inside if im typing that stuff 
[6:48:27] broadcaster turbo GreatSphynx: just different format 
[6:48:30] broadcaster turbo GreatSphynx: and different media types 
[6:48:47] bits-leader bizwizard667: id say with the amount of 90's or 2000s nostalgia going around its likely 
[6:48:56] vip sub-gift-leader plorf: yeah off the air is like the closest thing i can think of as far as like 
[6:49:00] vip sub-gift-leader plorf: being a digital variety show thing 
[6:49:17] bits-leader bizwizard667: indie games do a good job of scratching the itch but animations would be cool 
[6:49:34] FluffaWonderfluff: Oh yo I recognize Chris Landreth's name, I watched the Ryan doc a couple of years ago 
[6:49:47] vip sub-gift-leader plorf: i like how a lot of these productions mix artsy personal projects with more corporate produced stuff 
[6:49:48] twitch-recap-2023 Mahbonk: good morning 
[6:49:56] turbo TrueBlueVenue: gm bonk 
[6:49:59] broadcaster turbo GreatSphynx: this is done by a single guy 
[6:50:07] Origfx: OTrip
[6:50:09] subscriber snosa: OYOTrip
[6:50:12] thedoodler303: OYOTrip
[6:50:16] subscriber Hexagon_2: tobsEye tobsEye
[6:50:18] twitch-recap-2023 kozi_the_poopy_prince: greats8YoTrip
[6:50:19] subscriber twitch-recap-2023 plumblossomrobot: holy shit 
[6:50:20] turbo TrueBlueVenue: OYOTrip
[6:50:24] vip GodliestCat64: greats8YoTrip
[6:50:33] premium UroWasHere: Movie Trailer 
[6:50:35] Origfx: OYZTrip 16:9 gongo
[6:50:40] lego_palpatine: thats fucking sick 
[6:50:42] vip sub-gift-leader plorf: is this done in like a game engine 
[6:50:42] kephyll: woah its so crisp y 
[6:50:47] bits nyeaszel: MOREGO 
[6:50:52] broadcaster turbo GreatSphynx: yeah cuz its actually 4k 
[6:50:55] Tiphias: oh yeahh this is cool 
[6:51:01] premium UroWasHere: This is what star field could have been LUL
[6:51:02] thegmanrocks: it's beautiful 
[6:51:05] vip GodliestCat64: this is sick 
[6:51:05] subscriber snosa: zzooTrip
[6:51:07] Tiphias: awesome imagery throughout 
[6:51:08] vip sub-gift-leader plorf: yoooo terraforming 
[6:51:15] dresden81: damn that looks good 
[6:51:16] bits nyeaszel: zzooTrip
[6:51:22] vip sub-gift-leader plorf: nice hdr 
[6:51:34] vip premium fealiksg: pretty 
[6:51:35] Origfx: that looks cool as fuck 
[6:51:36] subscriber snosa: ya gorgeous 
[6:51:44] turbo TrueBlueVenue: I look at stuff like this and thing "I could never do this", then I realize that's only true because I'm discouraging myself from learning 
[6:51:47] vip sub-gift-leader plorf: got the harsh space lighting down 
[6:51:49] turbo TrueBlueVenue: *think 
[6:51:51] vip truthandpenitence: damn this is cool 
[6:51:55] dannysol_: "solstice 5" aka chats mom 
[6:52:09] superultracombo-2023 ultrahuhwhat: new homeworld looking good 
[6:52:15] vip premium fealiksg: @truebluedeuce you can do it work hard never give up 
[6:52:29] budderdog_: zzooTrip
[6:52:45] no_video ParadiseWeaver: WOO! I LOVE WAR 
[6:53:00] budderdog_: FISHWAR
[6:53:02] Origfx: factorio 2 looks great 
[6:53:07] twitch-recap-2023 Mahbonk: crazy, man 
[6:53:07] thedoodler303: FISHWAR
[6:53:30] vip sub-gift-leader plorf: its not often we get ultra widescreen on gongo
[6:53:33] dresden81: Homeworld: The Movie 
[6:53:36] vip sub-gift-leader plorf: usually the black bars are from 4:3 
[6:53:45] dannysol_: the scale of it all is really cool 
[6:53:55] thegmanrocks: THE FACTORIES 
[6:53:56] broadcaster turbo GreatSphynx: https://youtu.be/cntb3wcZdTw?si=6UTl8MyC3qjzMbna 
[6:54:01] vip GodliestCat64: that ship looks cool 
[6:54:05] subscriber snosa: ultrawideDoc as a treat 
[6:54:07] turbo TrueBlueVenue: @fealiksg Thank you, one of my new years resolutions is to create, not just consume 
[6:54:12] vip sub-gift-leader plorf: how did i know this was paul chaidesson lol 
[6:54:18] vip sub-gift-leader plorf: his style is so distinctive 
[6:54:34] Origfx: the creator's name is CHADeisson? Chadley
[6:54:55] vip bits-charity Maindog: I create chaos 
[6:55:00] Origfx: how long did this take to make, holy shit 
[6:55:00] subscriber snosa: tasty 
[6:55:16] dannysol_: this cannot continue 
[6:55:23] broadcaster turbo GreatSphynx: he made it in a year 
[6:55:24] vip sub-gift-leader plorf: crazy man 
[6:55:30] vip GodliestCat64: thats wild 
[6:55:33] vip GodliestCat64: greats8YoTrip
[6:55:36] Wisemann167: nice 
[6:55:37] subscriber snosa: catBoom
[6:55:37] Tiphias: damn that's crazy 
[6:55:40] twitch-recap-2023 Karmalsauce: Explosion
[6:55:43] subscriber snosa: that is nuts 
[6:55:43] thedoodler303: Explosion
[6:55:44] vip twitch-recap-2023 viahate: Explosion
[6:55:45] subscriber twitch-recap-2023 WolfzenSkiigh: Explosion
[6:55:45] twitch-recap-2023 Mahbonk: Thar she blows! 
[6:55:45] vip GodliestCat64: Explosion tendiAAH
[6:55:48] theFXexpert: bumBOOM
[6:55:50] twitch-recap-2023 WheresColonelPopcorn: Bwaaaa 
[6:55:59] Origfx: are the people CGI too? zzooTrip
[6:56:02] dannysol_: is that why hes still wearing his hard hat 
[6:56:04] broadcaster turbo GreatSphynx: no 
[6:56:05] broadcaster turbo GreatSphynx: lol 
[6:56:13] vip GodliestCat64: could you imagine lol 
[6:56:19] vip sub-gift-leader plorf: i honestly was considering it 
[6:56:24] thegmanrocks: I mean, it has to be very very well programmed factories 
[6:56:24] Origfx: i honestly thought they were 
[6:56:25] vip sub-gift-leader plorf: they look kinda uncanny 
[6:56:38] vip artist-badge Raxxmus: oh this is that new blender short 
[6:56:46] Takamatsu2: they are ai 
[6:56:48] subscriber snosa: the new blender 
[6:56:49] vip artist-badge Raxxmus: I really like this guys art 
[6:56:53] Origfx: he made this in blender too? god damn 
[6:56:54] premium Septicpunk_: this is pretty cool 
[6:57:03] vip artist-badge Raxxmus: I mean its like not a great short film but the art is really good 
[6:57:09] Origfx: i made a nice donut 
[6:57:10] vip sub-gift-leader plorf: yeah hes done a lot of high profile work 
[6:57:14] twitch-recap-2023 WheresColonelPopcorn: Surely this guy works for a major studio right? 
[6:57:27] vip artist-badge Raxxmus: I dont think so 
[6:57:28] vip sub-gift-leader plorf: hes done stuff for halo 
[6:57:57] bits-leader bizwizard667: i was gonna say this is giving me halo vibes 
[6:58:45] subscriber Creatures_Features: love death robot vibes 
[6:58:48] twitch-recap-2023 Karmalsauce: Clap
[6:58:49] vip GodliestCat64: Clap
[6:58:50] Origfx: halo isn't this cool 
[6:58:53] subscriber premium Yeven_Fox: Clap
[6:58:53] thedoodler303: Clap
[6:58:54] subscriber snosa: Clap
[6:58:54] vip twitch-recap-2023 kjb343: Clap
[6:58:55] turbo TrueBlueVenue: Clap
[6:58:55] subscriber Hexagon_2: Amazing 
[6:58:56] bits-leader bizwizard667: Clap
[6:58:59] vip artist-badge Raxxmus: Clap
[6:58:59] vip sub-gift-leader plorf: i only really saw s1 of love death and robots i think 
[6:59:02] twitch-recap-2023 WheresColonelPopcorn: Clap insanely good 
[6:59:03] vip truthandpenitence: I really liked that one 
[6:59:03] Origfx: Clap
[6:59:04] vip sub-gift-leader plorf: there were some cool shorts 
[6:59:05] FluffaWonderfluff: Clap
[6:59:13] thegmanrocks: Clap
[6:59:20] dannysol_: Clap
[6:59:21] Origfx: LDR is always good eyecandy 
[6:59:33] subscriber twitch-recap-2023 WolfzenSkiigh: Clap that was great 
[6:59:34] vip sub-gift-leader plorf: you guys ever see neil blomkamps short film stuff on youtube 
[6:59:35] Wisemann167: Clap
[6:59:37] subscriber Creatures_Features: Clap
[6:59:39] vip sub-gift-leader plorf: like OATS and shit 
[6:59:50] thegmanrocks: can it happen with the donught machine? 
[6:59:56] Origfx: I always get recommended OATS on netflix 
[6:59:57] bits-leader bizwizard667: underneath the bridge 
[7:00:06] bits nyeaszel: Clap
[7:00:08] thegmanrocks: can it produce donuts on its own and can't be stopped? 
[7:00:19] turbo TrueBlueVenue: All that CG being done by one guy is just...incredible 
[7:00:22] vip bits-charity Maindog: You get this by a single guy, then you get multi million dollar bullshit like the flash. 
[7:00:30] thedoodler303: @Maindog LUL
[7:00:37] vip sub-gift-leader plorf: woah this is blender? 
[7:00:39] vip GodliestCat64: greats8YoTrip
[7:00:43] subscriber snosa: blender moment 
[7:00:44] bits-leader bizwizard667: great stuff 
[7:00:48] BeamingButt: SCULLY!!!!!!! 
[7:00:50] dannysol_: its crazy what passion can do for a project 
[7:00:50] subscriber snosa: norway 
[7:00:54] Magolor: NORWAY 
[7:00:55] thedoodler303: Norway 
[7:00:59] turbo TrueBlueVenue: Norway moment 
[7:01:01] vip Snudl: 🇳🇴 
[7:01:07] vip GodliestCat64: on 
[7:01:10] subscriber Hexagon_2: dumbmo1Pepsiware
[7:01:13] Origfx: HUHH
[7:01:28] vip Snudl: dumbmo1Emerge
[7:01:29] vip GodliestCat64: greats8YoTrip
[7:01:30] bits-leader bizwizard667: pspStaring
[7:01:32] Magolor: 🇳🇴 
[7:01:33] subscriber Jablabber: I KNOW THIS
[7:01:37] Wisemann167: ewwfrance 
[7:01:40] bits nyeaszel: monkaS
[7:01:42] turbo TrueBlueVenue: found footage monkaS
[7:01:42] thegmanrocks: duende 
[7:01:43] Origfx: sweatFrog
[7:01:44] subscriber snosa: tendiAAH
[7:01:46] thedoodler303: GLEEBING
[7:01:48] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: greats8Roiker
[7:01:48] Rooks_Castle: ALERTA
[7:01:55] subscriber Jablabber: This is called Blood Milk right sphynx? 
[7:01:56] vip GodliestCat64: catJAMGF
[7:01:58] Origfx: oh we GLEEBING ? 
[7:01:59] subscriber snosa: GLEEBING holy shit 
[7:02:01] vip sub-gift-leader plorf: GLEEBING
[7:02:02] subscriber Hexagon_2: greats8Bruh
[7:02:02] budderdog_: nyansBoogie
[7:02:02] Rooks_Castle: catPls
[7:02:03] premium X_eroz: cirRave
[7:02:05] Tiphias: REAL 
[7:02:06] premium UroWasHere: dayym 
[7:02:06] thedoodler303: AlienDance
[7:02:07] bits-leader bizwizard667: greats8YoTrip
[7:02:07] bits nyeaszel: catPls
[7:02:08] vip Snudl: AlienDance
[7:02:08] turbo TrueBlueVenue: VIBE
[7:02:08] subscriber snosa: AlienDance
[7:02:08] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: Mobilization man is coming 
[7:02:09] broadcaster turbo GreatSphynx: idk its part of off the air 
[7:02:11] vip twitch-recap-2023 viahate: AlienDance
[7:02:11] dannysol_: hell yeah GLEEBING
[7:02:12] twitch-recap-2023 WheresColonelPopcorn: DinoDance DinoDance
[7:02:14] BeamingButt: retroi3Dance retroi3Dance retroi3Dance retroi3Dance retroi3Dance retroi3Dance
[7:02:14] ScrapyardSatyr: mikePls
[7:02:16] twitch-recap-2023 Mahbonk: carlPls
[7:02:20] subscriber premium Yeven_Fox: catPls
[7:02:26] Origfx: AlienDance odoSoyR
[7:02:32] thedoodler303: GLEEBING
[7:02:35] vip truthandpenitence: wideVIBE
[7:02:39] vip bits-charity Maindog: @greatsphynx Gilbert Garfield to screw with people. 
[7:02:39] vip sub-gift-leader plorf: did BTTV remove support for 7tv global emotes or something 
[7:02:41] subscriber premium Fecal_Sauce: Damn he getting down 
[7:02:42] vip sub-gift-leader plorf: i cant see aliendance 
[7:03:01] budderdog_: catPls
[7:03:02] thedoodler303: AlienDance
[7:03:05] lego_palpatine: love this fella 
[7:03:05] twitch-recap-2023 Karmalsauce: AlienDance
[7:03:05] DaWhatTheFox: AlienDance AlienDance
[7:03:06] turbo Navitron: odoKEK
[7:03:07] lego_palpatine: just wants to vibe 
[7:03:07] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: tilaroDance
[7:03:10] Bladestorm01: The SCP foundation greats8YoTrip
[7:03:20] Origfx: @plorf works for me 
[7:03:20] subscriber KatalepsyKills: AlienDance
[7:03:22] Magolor: he chillin while everyone goes crazy 
[7:03:22] BeamingButt: cmon baby, Get in the mood. These robots bounce 
[7:03:26] vip truthandpenitence: wideVIBE wideVIBE wideVIBE wideVIBE
[7:03:33] vip sub-gift-leader plorf: MorshuRTX
[7:03:39] bits-leader bizwizard667: slay 
[7:03:40] subscriber snosa: ?????????? 
[7:03:42] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: greats8SPRIGGLE
[7:03:43] DaWhatTheFox: catPls catPls catPls
[7:03:47] subscriber snosa: AlienDance
[7:03:48] Origfx: Funnywhitecat5
[7:03:58] BeamingButt: nvm. Not robots. EBEs 
[7:04:05] mr_ski_: carlPog
[7:04:10] Origfx: zzooTrip
[7:04:11] vip twitch-recap-2023 viahate: zzooTrip
[7:04:12] DaWhatTheFox: zzooTrip
[7:04:13] subscriber snosa: zzooTrip
[7:04:23] thedoodler303: zzooTrip
[7:04:26] subscriber KatalepsyKills: zzooTrip
[7:04:27] Wimp_Lo_: greats8ZooTrip
[7:04:37] BeamingButt: have you had your LSD today? 
[7:04:56] turbo Navitron: zzooTrip
[7:05:08] vip twitch-recap-2023 viahate: ew 
[7:05:11] broadcaster turbo GreatSphynx: zzooTrip
[7:05:12] subscriber twitch-recap-2023 WolfzenSkiigh: Same animator as Super Jail? 
[7:05:13] budderdog_: pee 
[7:05:23] subscriber snosa: odoAWOOGA
[7:05:23] mr_ski_: best visuals for concert 
[7:05:25] BeamingButt: superjail animator? 
[7:05:26] vip bits-charity Maindog: I have the weirdest boner 
[7:05:33] Origfx: catBlink
[7:05:33] premium UroWasHere: Superjail opening 
[7:05:35] vip premium lmaoboat: Life on the outside ain't what it used to be 
[7:05:36] mr_ski_: imagine this shit on the giant lcd ball in vegas lol! 
[7:05:37] thedoodler303: @BeamingButt feels like it 
[7:05:39] broadcaster turbo GreatSphynx: maybe it wouldnt be the first time they had stuff on off the air i dont think 
[7:05:40] Origfx: was gonna sail superjail 
[7:05:44] subscriber Hexagon_2: tobs69 SmonkTime
[7:05:46] Origfx: say* 
[7:05:58] BeamingButt: amazing 
[7:06:07] mr_ski_: frontal lobe gone 
[7:06:09] DaWhatTheFox: catJAMGF
[7:06:10] Origfx: did you ever play superjail here sphynx 
[7:06:14] bits-leader bizwizard667: pspKat
[7:06:17] thedoodler303: Corb
[7:06:18] broadcaster turbo GreatSphynx: no its too recent 
[7:06:22] superultracombo-2023 pjgrich: What the FUCK is this 
[7:06:30] subscriber snosa: nice crocs 
[7:06:31] away0404: those underwear look uncomfortable 
[7:06:37] superultracombo-2023 pjgrich: Lizard! 
[7:06:38] BeamingButt: =NOT CROCS WTF 
[7:06:48] broadcaster turbo GreatSphynx: even though this is recent too dataBruh
[7:06:49] Origfx: GTA 6 lookin wild 
[7:06:53] Magolor: IT'S FUCKIGN GEX 
[7:07:06] subscriber twitch-recap-2023 plumblossomrobot: YO ive seen this person's animations in a film museum in amsterdam 
[7:07:10] premium X_eroz: LUL
[7:07:12] thedoodler303: LUL
[7:07:13] superultracombo-2023 pjgrich: oh my LUL
[7:07:13] premium UroWasHere: "I bet that thing has corona" LUL
[7:07:14] vip sub-gift-leader plorf: catJamrgb
[7:07:22] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: sarabe6Dance
[7:07:23] turbo Navitron: I wonder when this was made atpCap
[7:07:23] twitchcon2018 Taizun: catPls
[7:07:23] thedoodler303: catJamrgb
[7:07:26] subscriber snosa: homk homk 
[7:07:29] intravenous_custard: whoaa wazzap every body 
[7:07:38] twitch-recap-2023 Mahbonk: probably the 90s limesSmug
[7:07:44] DaWhatTheFox: zzooTrip
[7:07:50] vip sub-gift-leader plorf: catJAM
[7:07:51] superultracombo-2023 pjgrich: catPls
[7:07:51] thedoodler303: catJAM
[7:07:52] BeamingButt: squarepusher!!!! 
[7:07:53] subscriber snosa: zzooTrip
[7:07:53] Origfx: catJAM
[7:07:54] premium hooligan_julian: fuck yeah 
[7:07:55] turbo TrueBlueVenue: catJAM
[7:07:55] subscriber Hexagon_2: ducknRoll
[7:07:57] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: tilaroHype
[7:07:58] vip Snudl: catJAM
[7:08:02] subscriber KatalepsyKills: catJAM
[7:08:02] Magolor: catJAM
[7:08:03] vip twitch-recap-2023 viahate: catJAM
[7:08:03] DaWhatTheFox: catJAM catJAM catJAM
[7:08:05] twitchcon2018 Taizun: @Mahbonk Widescreen format in the 90s? zzooTrip
[7:08:12] dannysol_: would 
[7:08:12] subscriber twitch-recap-2023 plumblossomrobot: the person who made that one wit the geckos has a lot of animations of them that were made during the covid era 
[7:08:13] premium hooligan_julian: meowJAMJAM RAGEY catJAMPARTY
[7:08:15] Origfx: catPls
[7:08:16] turbo TrueBlueVenue: For some reason I can't see any 7TV emotes I type 
[7:08:20] vip premium lmaoboat: YOO IM A FLOATING BRAIN 
[7:08:27] broadcaster turbo GreatSphynx: works for me in chatty 
[7:08:27] broadcaster turbo GreatSphynx: idk
[7:08:28] BeamingButt: hey 
[7:08:31] thedoodler303: HEY 
[7:08:36] vip GodliestCat64: catJAM
[7:08:37] twitch-recap-2023 WheresColonelPopcorn: doop 
[7:08:39] DaWhatTheFox: catJAM
[7:08:40] BeamingButt: ahhhhhhhh' 
[7:08:45] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: my 7tv extension has been broken for months 
[7:08:55] subscriber snosa: catJAM
[7:08:56] Origfx: ugliest kaiju 
[7:08:57] broadcaster turbo GreatSphynx: zzooTrip
[7:08:58] PoopingAstronaut: im so glad im tuning in now 
[7:09:03] premium UroWasHere: This feels very skibi 
[7:09:08] twitchcon2018 Taizun: FFZ with the 7TV Emotes add-on enabled in the FFZ Control Center is top notch 
[7:09:14] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: tilaroBOOM
[7:09:14] vip premium lmaoboat: mikePls
[7:09:22] Origfx: WAYTOODANK
[7:09:27] bits-leader bizwizard667: oh god 
[7:09:28] vip premium lmaoboat: WTFF
[7:09:36] BeamingButt: def squarepusher inspired at least 
[7:09:37] twitchcon2018 Taizun: Does this thing work? 
[7:09:39] Origfx: LICKA 
[7:09:43] vip GodliestCat64: Funnywhitecat5
[7:09:44] vip twitch-recap-2023 viahate: SillyCat
[7:09:47] DaWhatTheFox: catJamrgb
[7:09:49] turbo TrueBlueVenue: Is this an average episode of Off The Air? 
[7:09:52] turbo Navitron: zzooTrip
[7:09:57] vip Snudl: zzooTrip
[7:09:57] broadcaster turbo GreatSphynx: yeah an average more recent one 
[7:10:00] BeamingButt: retroi3Selina
[7:10:02] boilerplatejack: the special biscuits 
[7:10:04] broadcaster turbo GreatSphynx: i like the older ones more tbh 
[7:10:05] twitch-recap-2023 WheresColonelPopcorn: I'd say yes. Very odd things always on OTA 
[7:10:14] Origfx: catJamrgb
[7:10:14] broadcaster turbo GreatSphynx: lots of the more recent ones have stuff that feel like it was made more specifically for it 
[7:10:17] DaWhatTheFox: AlienDance AlienDance AlienDance
[7:10:24] subscriber Jablabber: Uhh 
[7:10:26] subscriber twitch-recap-2023 plumblossomrobot: how straight women hang out: 
[7:10:29] premium X_eroz: picBust
[7:10:30] broadcaster turbo GreatSphynx: even though i dont think it was 
[7:10:30] turbo Navitron: BERMAN
[7:10:30] vip sub-gift-leader plorf: Uhhh
[7:10:30] twitch-recap-2023 WheresColonelPopcorn: picBust
[7:10:32] subscriber HexenHell: I just woke up... wideHUH what did i come into? 
[7:10:32] Takamatsu2: needTrip
[7:10:34] vip premium fealiksg: human play 
[7:10:37] thedoodler303: catJAM
[7:10:41] Origfx: Buhh
[7:10:42] subscriber KatalepsyKills: bad human 
[7:10:49] Undreas: yo what up peeps anything good on tv? 
[7:10:54] broadcaster turbo GreatSphynx: OTrip
[7:10:56] DaWhatTheFox: lol 
[7:10:57] thedoodler303: LUL
[7:10:57] vip GodliestCat64: greats8YoTrip TOFU CHAN 
[7:10:59] boilerplatejack: tofuchan 
[7:11:01] thedoodler303: TOFU CHAN 
[7:11:01] vip sub-gift-leader plorf: ultraman OYOTrip
[7:11:01] no_video ParadiseWeaver: OYOTrip
[7:11:02] KingCoughin: LUL
[7:11:03] bits-leader bizwizard667: haiiii 
[7:11:03] DaWhatTheFox: OYZTrip
[7:11:03] subscriber twitch-recap-2023 plumblossomrobot: TOFU CHAN 
[7:11:06] just_a_vagabond: we gonging this late NogChamp
[7:11:07] vip Snudl: ConcernDoge
[7:11:08] subscriber snosa: hi tofu chan 
[7:11:09] twitch-recap-2023 WheresColonelPopcorn: sweet pupper 
[7:11:11] boilerplatejack: not one but two breads 
[7:11:13] subscriber Hexagon_2: ConcernDoge
[7:11:13] thedoodler303: peepoHappy
[7:11:13] Origfx: ty tofu chan 
[7:11:15] vip GodliestCat64: woag 
[7:11:24] DaWhatTheFox: zzooTrip
[7:11:26] turbo Navitron: zzooTrip woah 
[7:11:28] vip premium lmaoboat: Wholesome Cyriak 
[7:11:28] twitchcon2018 Taizun: zooTrip
[7:11:29] vip sub-gift-leader plorf: furakutoru 
[7:11:30] Origfx: WAYTOODANK
[7:11:30] vip premium fealiksg: greats8ZooTrip
[7:11:31] subscriber snosa: PopNemo
[7:11:33] just_a_vagabond: BARS 
[7:11:36] Takamatsu2: i love this dog race never had one i just like how they look 
[7:11:37] subscriber twitch-recap-2023 WolfzenSkiigh: It's bread. 
[7:11:42] subscriber KatalepsyKills: zzooTrip
[7:11:42] BeamingButt: i love you fractal 
[7:11:43] subscriber HexenHell: OYOTrip
[7:11:47] PoopingAstronaut: we're all shinubread 
[7:11:50] bits-leader bizwizard667: shibe 
[7:11:53] thedoodler303: OYOTrip
[7:11:54] DaWhatTheFox: FeelsStrongMan
[7:11:55] subscriber twitch-recap-2023 WolfzenSkiigh: Thank you, Tofu-chan 
[7:11:55] dannysol_: thanks dawg 
[7:11:57] turbo TrueBlueVenue: Thank you Tofu Chan 
[7:12:00] BeamingButt: shrooms were legal in japan until the early 2000s 
[7:12:03] Origfx: zzooTrip bruh 
[7:12:40] vip bits-charity Maindog: I can't fap to this 
[7:12:47] subscriber Creatures_Features: Clap ? 
[7:12:49] twitch-recap-2023 WheresColonelPopcorn: Clap
[7:12:50] vip GodliestCat64: Clap
[7:12:51] turbo TrueBlueVenue: Clap
[7:12:52] DaWhatTheFox: OYTrip
[7:12:53] Origfx: Clap
[7:12:54] bits-leader bizwizard667: Clap
[7:12:54] turbo Navitron: imagine banning a mushroom 
[7:12:54] subscriber Hexagon_2: Clap
[7:12:54] FluffaWonderfluff: Clap
[7:12:54] subscriber snosa: Clap
[7:12:55] subscriber HexenHell: Clap
[7:12:55] subscriber twitch-recap-2023 WolfzenSkiigh: Clap
[7:12:57] turbo Navitron: Clap
[7:12:58] premium UroWasHere: Clap
[7:12:59] thedoodler303: What episode of off the air was that? 
[7:13:03] just_a_vagabond: Clap
[7:13:03] premium X_eroz: Clap
[7:13:04] twitch-recap-2023 WheresColonelPopcorn: Dreams 
[7:13:06] thedoodler303: Clap
[7:13:10] subscriber HexenHell: Good freackin morning 
[7:13:12] thedoodler303: @WheresColonelPopcorn Ty 
[7:13:12] subscriber snosa: Sleepo
[7:13:13] premium X_eroz: Sleepo
[7:13:14] turbo Navitron: Sleepo
[7:13:15] KingCoughin: Clap
[7:13:15] DaWhatTheFox: Sleepo
[7:13:16] vip premium fealiksg: Sleepo
[7:13:16] phanton5000: Sleepo
[7:13:17] bits-leader bizwizard667: Sleepo ty sponx 
[7:13:17] subscriber twitch-recap-2023 WolfzenSkiigh: Sleepo
[7:13:17] vip GodliestCat64: Sleepo
[7:13:17] thedoodler303: Sleepo
[7:13:19] ScrapyardSatyr: sphynxPat osmoPat
[7:13:21] just_a_vagabond: oh Clap
[7:13:22] vip premium fealiksg: dataSleep
[7:13:22] FluffaWonderfluff: Sleepo
[7:13:23] vip sub-gift-leader plorf: BedgeCat
[7:13:26] broadcaster turbo GreatSphynx: osmo just spilled my whole bag of cheetos 
[7:13:28] Lastrin: ty for gongo sphynx good night 
[7:13:29] subscriber HexenHell: bingSleep
[7:13:31] subscriber snosa: oh god 
[7:13:31] vip GodliestCat64: NOOOO
[7:13:32] premium Septicpunk_: Night insomniac gongo lians 
[7:13:32] dannysol_: ty spinx 
[7:13:33] subscriber twitch-recap-2023 WolfzenSkiigh: time to dataSleep
[7:13:38] DaWhatTheFox: i really enjoyed this christmas gongo
[7:13:38] Wisemann167: long gongo Clap
[7:13:38] vip premium fealiksg: lil hellion 
[7:13:38] FluffaWonderfluff: osmoStare
[7:13:39] vip sub-gift-leader plorf: osmoStare
[7:13:39] KingCoughin: LUL snack time 
[7:13:39] vip bits-charity Maindog: Oh. Wait. There's my fap 
[7:13:40] subscriber Hexagon_2: Osmo dominance 
[7:13:42] grandfatigue: osmoD
[7:13:42] Origfx: dataSleep Clap great gongo
[7:13:44] turbo TrueBlueVenue: Thank you for gongo, Sphynx 
[7:13:45] bits-leader bizwizard667: osmoPat gj osmo 
[7:13:45] BeamingButt: tyvm <3
[7:13:47] vip Snudl: veryCat Mine 
[7:13:48] subscriber twitch-recap-2023 plumblossomrobot: osmoStare fuck ur cheetos 
[7:13:49] lego_palpatine: goodnight gongoers 
[7:13:51] subscriber twitch-recap-2023 SpecialAgentFoxMulderFBI: good nighto 
[7:13:51] vip twitch-recap-2023 viahate: thanks for the gongo sphynxPat
[7:13:52] FluffaWonderfluff: Osmo want cheetos osmoStare
[7:13:52] subscriber twitch-recap-2023 WolfzenSkiigh: osmoLick Chaos 
[7:13:52] subscriber Hexagon_2: Thanks Sphynx 
[7:13:56] DaWhatTheFox: catJamrgb catJamrgb catJamrgb
[7:14:01] subscriber twitch-recap-2023 WolfzenSkiigh: rest well everyone 
[7:14:02] no_video ParadiseWeaver: Sleepo gn 
[7:14:04] vip GodliestCat64: got too mischievous osmoBlep
[7:14:06] turbo TrueBlueVenue: Wait I remember, didn't this start as showing Star Trek episodes? 
[7:14:07] bits-leader bizwizard667: my cat loves cheetos but only the puffs 
[7:14:15] subscriber twitch-recap-2023 WolfzenSkiigh: ty for blessed gongo
[7:14:17] moderator partner DesertP: good gongo xmas this year 
[7:14:17] subscriber snosa: ty stream sphynxPat
[7:14:18] BeamingButt: dope track 
[7:14:20] moderator partner DesertP: ty 
[7:14:23] vip sub-gift-leader plorf: daxMug we hate star trek 
[7:14:30] thedoodler303: Before I go Sleepo what song is this? 
[7:14:34] vip GodliestCat64: i actually really hate everything stra trek 
[7:14:35] vip GodliestCat64: BERMAD
[7:14:35] subscriber snosa: yeah ty for all the christmas stuff it was rly fun 
[7:14:35] vip bits-charity Maindog: @desertp you're everywhere 
[7:14:36] subscriber glitchcon2020 LnLessa: good gongo
[7:14:37] subscriber twitch-recap-2023 plumblossomrobot: mk time for me to go abt my day, thank u for strim sphynx. have a good st stephen's day everyone sphynxPat
[7:14:41] lego_palpatine: @GodliestCat64 based 
[7:14:43] subscriber hunnietoots: gongo Clap
[7:14:45] grandfatigue: what a longo gongo nighto sphynxPat PETPET
[7:14:57] DaWhatTheFox: campfireCats
[7:15:02] subscriber snosa: campfireCats
[7:15:02] Bladestorm01: Good Christmas gongo sphynxPat osmoPat
[7:15:02] bits-leader bizwizard667: @thedoodler303 81 Autumn - Uyama Hiroto 
[7:15:12] turbo TrueBlueVenue: Glad I could catch the last couple hours of Gongo, this is nice <3
[7:15:13] thedoodler303: @doc11d7 ty 
[7:15:18] bits-leader bizwizard667: merry xmas gongo nites 
[7:15:24] broadcaster turbo GreatSphynx: odoNo i was gonna eat those 
[7:15:27] broadcaster turbo GreatSphynx: ty for watching 
[7:15:31] broadcaster turbo GreatSphynx: merry christmas 
[7:15:36] DaWhatTheFox: catKISS
[7:15:37] broadcaster turbo GreatSphynx: i actually still have some more christmas stuff lmao 
[7:15:39] subscriber twitch-recap-2023 plumblossomrobot: merry christmas to u too 
[7:15:42] vip artist-badge Raxxmus: thanks sphynx 
[7:15:42] vip premium fealiksg: merr krims 
[7:15:43] broadcaster turbo GreatSphynx: ill do a little bit the next few streams 
[7:15:51] moderator partner DesertP: sick 
[7:15:55] subscriber snosa: nice 
[7:15:58] bits-leader bizwizard667: we still got 10 days odoKEK
[7:16:00] subscriber twitch-recap-2023 WolfzenSkiigh: extended christmas 
[7:16:01] subscriber twitch-recap-2023 plumblossomrobot: remember chat, almost christmas means it wasnt christmas 
[7:16:01] vip GodliestCat64: thanks for the stream BedgeCat
[7:16:02] turbo TrueBlueVenue: merry christmas, Sphynx, gongo , and chat 
[7:16:05] vip artist-badge Raxxmus: give osmo a christmas pat from me 
[7:16:10] vip sub-gift-leader plorf: picardEgg
[7:16:14] twitch-recap-2023 shrimp1nainteasy: meryy gongo gongoCrystal
[7:16:14] vip bits-charity Maindog: @greatsphynx shove cheeto in mouth like goblin 
[7:16:21] DaWhatTheFox: wideVIBE
[7:16:23] thedoodler303: Sleepo
[7:16:25] subscriber snosa: almost christmas means it wasn't christmas!!!! 
[7:16:44] broadcaster turbo GreatSphynx: i saved some i had to throw others away 
[7:16:54] budderdog_: Sleepo Sleepo
[7:16:58] budderdog_: BedgeCat
[7:16:59] subscriber snosa: catJammingPolitely
[7:16:59] bits-leader bizwizard667: vineKermiepls
[7:17:00] vip premium fealiksg: greats8Bounce
[7:17:01] vip sub-gift-leader plorf: catJamrgb
[7:17:02] turbo Navitron: Sleepo
[7:17:03] DaWhatTheFox: catJamrgb
[7:17:12] vip twitch-recap-2023 viahate: boonDance boonDance boonDance
[7:17:55] subscriber Hexagon_2: Sleepo
[7:18:02] DaWhatTheFox: catJammingPolitely catPls Yeat catJammingPolitely catPls
[7:18:03] subscriber snosa: wideVIBE
[7:18:04] vip premium lmaoboat: This sounds kinda Jack Staubery 
[7:18:13] broadcaster turbo GreatSphynx: its connan mockasin 
[7:18:21] vip bits-charity Maindog: Skibidi toilet porn exists 
[7:18:41] subscriber snosa: zzooTrip
[7:18:51] bits-leader bizwizard667: thanks maindog for that info 
[7:19:00] bits-leader bizwizard667: i have some research to do 
[7:19:27] DaWhatTheFox: meowJAMJAM meowJAMJAM meowJAMJAM
[7:19:34] turbo TrueBlueVenue: How do you find new music? Pick a genre on Spotify and hit shuffle? 
[7:19:53] bits nyeaszel: catJAMGF
[7:20:05] broadcaster turbo GreatSphynx: i used to i dont think spotify's recs are as good anymore 
[7:20:06] DaWhatTheFox: gongo leads me to find about new music 
[7:20:10] carbine50: emmiakMeowmeowmeow
[7:20:14] broadcaster turbo GreatSphynx: but sometimes spotify recommedations, sometimes youtube recs 
[7:20:16] broadcaster turbo GreatSphynx: i read some like 
[7:20:30] vip Snudl: odoCrunge Nerys, this music is making me melt 
[7:20:32] broadcaster turbo GreatSphynx: music sites and stuff and i will listen to like whatever is popular or high rated to see if its actually worth it 
[7:20:42] broadcaster turbo GreatSphynx: i dont watch anthony fantano regularly but ill watch his yearly summary videos 
[7:20:49] broadcaster turbo GreatSphynx: and some other tubers 
[7:21:03] vip sub-gift-leader plorf: i should try picking up spotify just to stream some newer stuff 
[7:21:09] vip sub-gift-leader plorf: i never bothered w it 
[7:21:14] bits-leader bizwizard667: i like spotify quite a lot 
[7:21:19] DaWhatTheFox: BedgeCat
[7:21:31] bits nyeaszel: wideVIBE
[7:21:37] turbo TrueBlueVenue: Cool, I was looking for a way to stop going through the same few playlists of old songs over and over, so I'll try that 
[7:21:44] broadcaster turbo GreatSphynx: yeah idk also like for me there are just some channels that upload good stuff 
[7:21:52] broadcaster turbo GreatSphynx: terminal passage on youtube 
[7:21:55] broadcaster turbo GreatSphynx: and my analog journal 
[7:21:55] vip sub-gift-leader plorf: yea 
[7:22:04] bits-leader bizwizard667: yea spotify recs can be pretty good sometimes. it goes off genre so if you wanna find similar stuff just let it autoplay 
[7:22:07] broadcaster turbo GreatSphynx: and like library music is always a good go to 
[7:22:08] vip sub-gift-leader plorf: i see that Ambiance channel a lot 
[7:22:11] DaWhatTheFox: meowJAMJAM catJAMGF meowJAMJAM catJAMGF
[7:22:29] subscriber snosa: catJammingPolitely
[7:22:34] broadcaster turbo GreatSphynx: i listen to compilations sometimeson youtube to look for specific artists 
[7:23:07] broadcaster turbo GreatSphynx: idk whenever i get bored with what im listening to ill try and go outside of my comfort zone a bit 
[7:23:20] turbo TrueBlueVenue: That's what I need to do more, yeah 
[7:23:39] broadcaster turbo GreatSphynx: theres also whole genres of stuff where the whole goal is sorta the ambiance of it so like 
[7:23:51] broadcaster turbo GreatSphynx: i know i can put on like a macroblank or haircuts for men album and it doesnt matter which one and know what ill get 
[7:23:52] bits-leader bizwizard667: this reminds me of ratatat lp4 a lil bit 
[7:23:58] broadcaster turbo GreatSphynx: same with a lot of vaporwave stuff 
[7:24:00] vip premium lmaoboat: I remember using Pandora at work years ago, and it was like "Oh, you didn't thumbs down The Eagles or Devil Went Down to Georgia? Well enjoy spending the whole down thumbs downing My Truck Cold Beer 9/11 KKona Music" 
[7:24:09] broadcaster turbo GreatSphynx: and the library music stuff is literally categorized into styles for like people to license 
[7:24:22] broadcaster turbo GreatSphynx: this is hot sugar 
[7:24:44] bits-leader bizwizard667: bounceDok
[7:24:46] vip sub-gift-leader plorf: i need to organize my YT playlists better 
[7:24:54] vip sub-gift-leader plorf: and just have a HFM macroblabnk type playlist 
[7:25:02] broadcaster turbo GreatSphynx: it also helps if you just make a 2nd account for music 
[7:25:09] broadcaster turbo GreatSphynx: and then you dont get as many recommendations for normal youtube shit 
[7:25:10] DaWhatTheFox: catJammingPolitely Corb
[7:25:23] bits nyeaszel: holy moly this slaps 
[7:25:48] subscriber turbo TrueBlueVenue: truebluedeuce subscribed at Tier 1. They've subscribed for 2 months! Thank you for gongo
[7:25:53] broadcaster turbo GreatSphynx: ty true blue 
[7:26:06] broadcaster turbo GreatSphynx: also navitron if you are still here i missed u 
[7:26:09] broadcaster turbo GreatSphynx: ty 
[7:26:12] broadcaster turbo GreatSphynx: for rescub 
[7:26:45] subscriber bits-leader bizwizard667: doc11d7 subscribed at Tier 1. They've subscribed for 3 months! gong 
[7:26:55] broadcaster turbo GreatSphynx: ty doc 
[7:26:59] broadcaster turbo GreatSphynx: bounceDoc bounceDok bounceDoc
[7:27:02] subscriber snosa: VIBE
[7:27:05] subscriber bits-leader bizwizard667: bounceDok bounceDok bounceDok
[7:27:22] DaWhatTheFox: ultrawideDoc
[7:27:22] subscriber bits-leader bizwizard667: now i can greats8Daxmug
[7:27:30] vip premium fealiksg: bounceDok bounceDoc bounceDok bounceDoc
[7:27:51] subscriber turbo TrueBlueVenue: wideDoc
[7:28:03] bits nyeaszel: doot 
[7:28:05] subscriber snosa: catJammingPolitely
[7:28:06] vip premium fealiksg: whyDoc
[7:28:10] DaWhatTheFox: catJamrgb catJamrgb
[7:28:14] subscriber bits-leader bizwizard667: greats8JAM
[7:28:17] vip sub-gift-leader plorf: ultrawideDoc
[7:28:18] subscriber KingCoughin: KingCoughin subscribed at Tier 1. They've subscribed for 2 months! peace and have a good morning 
[7:28:19] vip twitch-recap-2023 viahate: catPls
[7:28:24] broadcaster turbo GreatSphynx: ty king 
[7:28:27] bits nyeaszel: song tittle of the last one? 
[7:28:34] twitchcon2018 Taizun: GLaDOS? 
[7:28:43] BeamingButt: runrunrunrunrun 
[7:28:43] DaWhatTheFox: Yeat Yeat Yeat
[7:28:45] subscriber bits bizwizard667: catPls
[7:28:48] bits nyeaszel: Yeat
[7:28:53] broadcaster turbo GreatSphynx: uhhh last one was hot sugar 
[7:28:59] bits nyeaszel: thx 
[7:29:02] DaWhatTheFox: wideVIBE wideVIBE
[7:29:08] subscriber snosa: wideVIBE
[7:29:12] BeamingButt: AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH 
[7:29:14] broadcaster turbo GreatSphynx: frosted glass 
[7:29:15] vip premium fealiksg: wideVIBE
[7:29:16] broadcaster turbo GreatSphynx: is the song 
[7:29:18] vip sub-gift-leader plorf: RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam RobertJam
[7:29:27] subscriber bits bizwizard667: greats8ZooTrip ren ren ren ren ren 
[7:29:27] bits nyeaszel: zzooTrip
[7:29:28] BeamingButt: AIR - Run 
[7:29:43] no_video ParadiseWeaver: love hot sugar but only listen to it recently here on gongo as a treat 
[7:29:44] subscriber JoGoBeans: zzooTrip
[7:29:50] broadcaster turbo GreatSphynx: i wish air still made music together 
[7:30:06] Magolor: GlaDOS popping off 
[7:30:08] subscriber bits bizwizard667: oh skate videos are another good way to find music greats8Bruh found air from an old eS vid 
[7:30:12] DaWhatTheFox: catPls
[7:30:27] BeamingButt: luckily they made enough music to round out their library. Weird ass instrumental albums and side projects too 
[7:30:33] broadcaster turbo GreatSphynx: i first heard air on early top gear 
[7:30:37] vip GodliestCat64: catJammingPolitely catJammingPolitely
[7:30:38] subscriber JoGoBeans: Wawa
[7:30:39] BeamingButt: the virgin suicides soundtrack 
[7:30:43] subscriber bits bizwizard667: ooo top gear had a lot of good music 
[7:30:46] subscriber snosa: catJammingPolitely
[7:30:50] DaWhatTheFox: meowJAMJAM meowJAMJAM meowJAMJAM
[7:30:51] vip sub-gift-leader plorf: i always say i should listen to more air 
[7:30:55] vip sub-gift-leader plorf: but i never get their albums 
[7:31:00] broadcaster turbo GreatSphynx: yeah i found a lot of good artists from top gear lol 
[7:31:01] BeamingButt: AIR has a heck of a lot of banger b-sides you all should seek out if you havent 
[7:31:02] broadcaster turbo GreatSphynx: in like mid 2000s 
[7:31:08] vip sub-gift-leader plorf: top gear plays a lot of good music 
[7:31:16] subscriber turbo TrueBlueVenue: looking up air rn 
[7:31:27] subscriber bits bizwizard667: pretty sure they've used my bloody valentine and aphex twin on top gear 
[7:31:30] subscriber bits bizwizard667: Based
[7:31:42] vip sub-gift-leader plorf: they play a lot of hybrid 
[7:31:49] vip sub-gift-leader plorf: and boards of canada 
[7:31:54] broadcaster turbo GreatSphynx: dataBruh
[7:32:01] subscriber bits bizwizard667: SHAKE SHAKE SHAKE
[7:32:07] twitchcon2018 Taizun: TombRaid
[7:32:07] BeamingButt: good day 
[7:32:29] subscriber snosa: VIBE
[7:32:30] subscriber turbo TrueBlueVenue: Shit there's like five bands named air 
[7:32:31] DaWhatTheFox: VIBE VIBE VIBE
[7:32:32] bits nyeaszel: zzooTrip
[7:32:38] twitch-recap-2023 Karmalsauce: VIBE
[7:32:41] no_video ParadiseWeaver: VIBE
[7:32:46] twitchcon2018 Taizun: KKona
[7:32:47] subscriber turbo TrueBlueVenue: VIBE
[7:32:48] subscriber bits bizwizard667: VIBE
[7:32:58] twitch-recap-2023 Karmalsauce: CORN
[7:32:59] subscriber bits bizwizard667: CORN
[7:33:02] subscriber snosa: CORN
[7:33:10] vip Snudl: CORN
[7:33:12] vip twitch-recap-2023 viahate: gn everyone Sleepo
[7:33:13] subscriber snosa: byebye 
[7:33:19] vip sub-gift-leader plorf: Sleepo
[7:33:32] broadcaster turbo GreatSphynx: night 
[7:33:33] twitch-recap-2023 Karmalsauce: GLEEBING
[7:33:35] bits nyeaszel: nini